Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer information in this study.
| Gene Symbol | Primer Sequences |
F or R | Assay | Species | Size (bp) | Accession |
|---|---|---|---|---|---|---|
| CDKN1A | CGGAACAAGGAGTCAGACATT | F | q-PCR | Human | 105 | NM_00389.5 |
| CDKN1A | AGTGCCAGGAAAGACAACTAC | R | q-PCR | Human | 105 | NM_00389.5 |
| BAK | AGGGCTTAGGACTTGGTTTG | F | q-PCR | Human | 100 | U16811.1 |
| BAK | GGGATTCCTAGTGGTGTTGATA | R | q-PCR | Human | 100 | U16811.1 |
| 18 S | CACGGACAGGATTGACAGATT | F | q-PCR | Human | 119 | NR_145820 |
| 18 S | GCCAGAGTCTCGTTCGTTATC | R | q-PCR | Human | 119 | NR_145820 |
