| Antibodies |
|
| TUJ1 |
Sigma-Aldrich |
T2200 |
| Alexa Fluoro 488 conjugated goat anti-rabbit secondary |
Invitrogen |
A11034 |
| anti-NMNAT2 (B-10) mouse monoclonal IgG1 |
Santa Cruz |
sc-515206 |
| Anti-Stathmin 1 Rabbit Monoclonal Antibody |
Abcam |
ab52630 |
| anti-SCG10 |
Shin et al. (2012)
|
N/A |
| Anti-STMN3 Rabbit Polyclonal Antibody |
Proteintech |
11311-1-AP |
| Anti-STMN4 Rabbit Polyclonal |
Proteintech |
12027-1-AP |
| Anti-HSP90 Rabbit IgG |
Cell Signaling Technologies |
C45G5 |
| anti-ChAT goat antibody |
Millipore Sigma-Aldrich |
AB144P |
| Cy3 anti-goat |
Jackson Immunoresearch |
705-166-147 |
| Alexa Fluoro-488 goat anti-rabbit IgG (H + L) |
Invitrogen |
A21121 |
| PGP9.5 antibody |
Millipore |
AB1761 |
| Goat anti-Rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody, Cyanine3 |
Invitrogen |
A10520 |
| 2H3 |
DHSB |
AB2314897 |
| SV2 |
DSHB |
AB2315387 |
| Alexa fluoro-568 anti-mouse |
Thermo Scientific |
A-21124 |
|
| Chemicals, peptides, and recombinant proteins |
|
| Toluidine Blue O |
Fisher Scientific |
T16125 |
| cOmplete, EDTA-free Protease Inhibitor Cocktail |
Sigma-Aldrich |
11873580001 |
| Laminin, Mouse, natural |
Sigma-Aldrich |
23017015 |
| Ammonium formate |
Sigma-Aldrich |
70221-100G-F |
| Osmium Tetroxide |
Sigma-Aldrich |
251755-10mL |
| Nerve growth factor (NGF) |
Sigma-Aldrich |
N6009-4X25UG |
| Neurobasal Medium |
ThermoFisher |
21103049 |
| Penicillin-Streptomycin (10,000 U/mL) |
ThermoFisher |
15140122 |
| Poly-D-lysine hydrobromide |
Sigma-Aldrich |
P7280 |
| 5-Fluoro-2′-deoxyuridine (FUDR) |
Sigma-Aldrich |
F0503 |
| B-27 Supplement, serum free |
ThermoFisher |
17504044 |
| D-(+)-Glucose solution |
Sigma-Aldrich |
G8644 |
| Paraformaldehyde, 32% solution |
Electron Microscopy Sciences |
15714-S |
| Fetal Bovine Serum, Heat Inactivated |
ThermoFisher |
10500064 |
|
| Critical commercial assays |
|
| Pierce BCA Protein Assay Kit |
ThermoFisher |
23227 |
| Araldite 502 epoxy resin solution |
Electron Microscopy Science |
13900 |
| Spurr Resin kit |
Electron Microscopy Science |
14300 |
| Rotarod Assay |
Panlab |
LE8205 |
| Viking Quest Electromyography Device |
Nicolet |
N/A |
|
| Experimental models: Organisms/strains |
|
| Mouse: Stmn2 KO |
This paper |
N/A |
| Mouse: Stmn2 floxed |
This paper |
N/A |
| Mouse: Rosa26-LSL-Cas9 knockin Cas9 mouse |
The Jackson Laboratory |
JAX:024857 |
| Mouse: ChAT-IRES-Cre |
The Jackson Laboratory |
JAX:006410 |
| Mouse: SARM1 B6.129X1-Sarm1tm1Aidi/J |
The Jackson Laboratory |
JAX:018069 |
|
| Oligonucleotides |
|
| Guide RNA targeting STMN2 Sequence #1: AGGTGAAGCAGATCAACAAC |
This paper |
N/A |
| Guide RNA targeting STMN2 Sequence #2: GAAGAAAGACCTGTCTCTGG |
This paper |
N/A |
| Scramble guide RNA sequence: CGCGGCAGCCGGTAGCTATG |
This paper |
N/A |
|
| Recombinant DNA |
|
| FCIV- NC vector |
Essuman et al. (2017)
|
N/A |
| Plasmid: EB3-mNeonGreen |
Chertkova et al. (2017)
|
Addgene #98881 |
| Plasmid: LentiGuide-Puro |
Sanjana et al. (2014)
|
Addgene #52963 |
|
| Software and algorithms |
|
| Graph Pad Prism 9 |
GraphPad Software |
https://www.graphpad.com/scientific-software/prism/
|
| Kymolyzer |
Basu et al. (2020)
|
https://github.com/ThomasSchwarzLab/KymolyzerCodes
|
| KymoButler |
Jakobs et al. (2019)
|
https://www.wolframcloud.com/objects/deepmirror/Projects/KymoButler/KymoButlerForm
|
| ImageJ |
Schneider et al. (2012)
|
RRID:SCR_003070 |
|
| Other |
|
| FluoroDishes |
World Precision Instruments |
FD35-100 |
| 4-well Chamber Slides |
Fischer Scientific |
08-774-25 |
