Skip to main content
. 2022 Jul 27;12:12828. doi: 10.1038/s41598-022-16914-9

Table 3.

Oligonucleotide sequences to form DNA nanostructures.

Name Sequence 5′ → 3′ Modification
p-cNL-B48 acacacacacaactaatcagcgttcgatgcttccgactaatcagccatatcagcttacgacta 5′ NH2
n atttagtttctatca none
n*o tgatagaaactaaatataatatgcgagcca 5′ NH2
o*p* tggctcgcatattattagttgtgtgtgtgt 5′ NH2
NL-B48 tagtcgtaagctgatatggctgattagtcggaagcatcgaacgctgat 5′ Biotin

Part n is complementary to part n*; part o to part o *; p to p* and cNL-B48 is complementary to NL-B48, which is already immobilized on the gold electrode of the switchSENSE device (without Biotin). For ELISAs, NL-B48 was ordered with 5´ Biotin to attach it to NeutrAvidin on the ELISA plate.