Table 3.
Oligonucleotide sequences to form DNA nanostructures.
Name | Sequence 5′ → 3′ | Modification |
---|---|---|
p-cNL-B48 | acacacacacaactaatcagcgttcgatgcttccgactaatcagccatatcagcttacgacta | 5′ NH2 |
n | atttagtttctatca | none |
n*o | tgatagaaactaaatataatatgcgagcca | 5′ NH2 |
o*p* | tggctcgcatattattagttgtgtgtgtgt | 5′ NH2 |
NL-B48 | tagtcgtaagctgatatggctgattagtcggaagcatcgaacgctgat | 5′ Biotin |
Part n is complementary to part n*; part o to part o *; p to p* and cNL-B48 is complementary to NL-B48, which is already immobilized on the gold electrode of the switchSENSE device (without Biotin). For ELISAs, NL-B48 was ordered with 5´ Biotin to attach it to NeutrAvidin on the ELISA plate.