Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of dsODN complementary oligonucleotides.
| Oligo (Name) | sequence 5’ to 3’ | Purpose |
|---|---|---|
| oGS1 (dsODN FWD) | /5Phos/GTTTAATTGAGTTGTCATATGTTAATAACGGT*A*T | use for dsODN annealing |
| oGS2 (dsODN REV) | /5Phos/ATACCGTTATTAACATATGACAACTCAATTAA*A*C | use for dsODN annealing |
/5Phos/ indicates 5’ phosphorylation
designates phosphorothioate linkage. S
