Table 1.
Primer information: RT-qPCR gene, primer and target/amplicon information for the reference gene RPL22 and investigated target genes. Tm: melting temperature of primer/specific qPCR product (amplicon), %GC: guanine/cytosine content, bp: base pairs.
| Gene Symbol | Gene Name (Mus Musculus) | Gene Function | Accession Number (NCBI Gene Bank) | Chromosoma Location (Length) | 5′-Forward Primer-3′ (Length/Tm/GC) | 5′reverse Primer-3′ (Length/Tm/GC) | Primer Location | Amplicon Length | Amplicon Location (bp of Start/Stop) | Intron-Flanking (Length) | Variants Targeted (Transcript/ Splice) |
|---|---|---|---|---|---|---|---|---|---|---|---|
| RPL22 | ribosomal protein L22 | translation of mRNA in protein | NM_000983 | 1; 1p36.31 (2061 bp) |
tgattgcacccaccctgtag (20 bp/59.67 °C/55%GC) |
ggttcccagcttttccgttc (20 bp/59.4 °C/55%GC) |
Exon 2/ Exon 3 |
98 | 91/188 | yes | yes |
| IL-6 | Interleukin 6 | important role in bone metabolism; osteoclastogenesis | NM_000600 | 7; 7p15.3 (1127 bp) |
catcctcgacggcatctcag (20 bp/60.32 °C/60%GC) |
tcaccaggcaagtctcctca (20 bp/60.47 °C/55%GC) |
Exon 2/ Exon 4 |
164 | 240/403 | yes | yes |
| IL-8 | Interleukin 8 | important role in bone metabolism; osteoclastogenesis | NM_000584 | 4; 4q13.3 (1642 bp) |
catactccaaacctttccacc (21 bp/57.9 °C/47,6%GC) |
cttcaaaaacttctccacaacc (22 bp/56.9 °C/40.9%GC) |
Exon 2/ Exon 3 |
167 | 206/372 | yes | yes |
| VEGF A |
vascular endothelial growth factor A | induces proliferation and migration of vascular endothelial cells | NM 001171623 | 6p21.1 (3660 bp) |
GGAGGGCAGAATCATCACGAA (21 bp/60.1 °C/52.3%GC) |
GGTACTCCTGGAAGATGTCCAC (22 bp/59.8 °C/54.5%GC) |
Exon 2/ Exon 3 |
100 | 1153/1211 | yes | yes |
| PTGS2 COX2 |
prostaglandin-endoperoxide synthase 2 | involved in prostaglandin synthesis | NM_000963 | 1q31.1 (4510 pb) |
GATGATTGCCCGACTCCCTT (20 bp/59.8 °C/55%GC) | GGCCCTCGCTTATGATCTGT (20 pb/59.6 °C/55%GC) | Exon 4/ Exon 5 |
185 | 560/725 | yes | yes |