Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Aug 1.
Published in final edited form as: J Mol Endocrinol. 2022 Jun 23;69(2):357–376. doi: 10.1530/JME-21-0242

Insulin signaling in the heart is directly and early impaired by growth hormone

Marina C Muñoz 1, Verónica G Piazza 1, Valeria Burghi 1,a, Jorge F Giani 1,b, Carolina S Martinez 1,c, Nadia S Cicconi 1, Nadia V Muia 1, Yimin Fang 2, Sergio Lavandero 3,4, Ana I Sotelo 1, Andrzej Bartke 2, Patricia A Pennisi 5, Fernando P Dominici 1, Johanna G Miquet 1
PMCID: PMC9339477  NIHMSID: NIHMS1813926  PMID: 35608964

Abstract

Growth hormone (GH) exerts major actions in cardiac growth and metabolism. Considering the important role of insulin in the heart and the well-established anti-insulin effects of GH, cardiac insulin resistance may play a role in the cardiopathology observed in acromegalic patients. As conditions of prolonged exposure to GH are associated with a concomitant increase of circulating GH, IGF-1 and insulin levels, to dissect the direct effects of GH, in this study we evaluated the activation of insulin signaling in the heart using four different models: 1) transgenic mice overexpressing GH, with chronically elevated GH, IGF-1 and insulin circulating levels, 2) liver IGF-1-deficient mice, with chronically elevated GH and insulin but decreased IGF-1 circulating levels, 3) mice treated with GH for a short period of time, and 4) primary culture of rat cardiomyocytes incubated with GH. Despite the differences in the development of cardiomegaly and in the metabolic alterations among the three experimental mouse models analysed, exposure to GH was consistently associated with a decreased response to acute insulin stimulation in the heart at the receptor level and through the PI3K/Akt pathway. Moreover, a blunted response to insulin stimulation of this signaling pathway was also observed in cultured cardiomyocytes of neonatal rats incubated with GH. Therefore, the key novel finding of this work is that impairment of insulin signaling in the heart is a direct and early event observed as a consequence of exposure to GH, which may play a major role in the development of cardiac pathology.

Keywords: insulin, GH, heart, signaling

Introduction

Growth hormone (GH) plays an important role in the development and function of the normal heart, regulating cardiac growth, myocardial contractility, and vascular system, therefore contributing to the maintenance of cardiac mass and function (Isgaard et al. 2015; Colao et al. 2019). GH exerts its effects directly through its receptor (GHR) or through the induction of insulin-like growth factor 1 (IGF-1) in liver and other tissues, which then acts through its receptor (IGF-1R). Cardiomyocytes express GHR and IGF-1R, and GH upregulates IGF-1 mRNA myocardial expression, therefore, GH direct effects have not been clearly differentiated from those mediated by IGF-1, either in an endocrine or autocrine/paracrine way (Isgaard et al. 2015; Colao et al. 2019).

Acromegalic cardiomyopathy is characterized by biventricular concentric hypertrophy with interstitial fibrosis and lympho-mononuclear infiltration (Isgaard et al. 2015; Sharma et al. 2017; Colao et al. 2019). The pathogenesis of this condition is complex, as GH and IGF-1 not only act directly in the heart, but they also exert indirect effects by inducing arterial hypertension and glucose and lipid metabolic disorders, resulting in cardiac toxicity, hypertrophy and remodeling. The prolonged exposure to GH in active acromegaly leads to insulin resistance, glucose intolerance and, ultimately, diabetes. Insulin resistance is believed to play an important role in the development of many of the comorbidities associated with acromegaly, including cardiovascular disease. The hyperinsulinemia associated with GH excess causes a reduction in insulin receptor (IR) levels and impairment of its kinase activity; in addition, crosstalk between GH and insulin signaling at the post-receptor level plays a crucial role in GH-induced insulin resistance (Dominici et al. 2005; Olarescu and Bollerslev 2016; Kim and Park 2017). Changes in the myocardial sensitivity to insulin action affect cardiac metabolism and function. Indeed, insulin resistance in the heart may lead to molecular, histological, and functional alterations associated with cardiac pathology (Bertrand et al. 2008; Abel et al. 2012).

Considering the important role of insulin in the heart and the anti-insulin effects of GH, cardiac insulin resistance may play an important role in the cardiac pathology observed in acromegalic patients. We have previously demonstrated that transgenic mice overexpressing GH exhibit impaired insulin signaling in the heart, characterized by basal activation of insulin signaling but decreased sensitivity to acute insulin stimulation at several signaling steps downstream of the IR (Miquet et al. 2011) . As GH-overexpressing mice exhibit a concomitant increase of circulating GH, IGF-1 and insulin levels, it was not clear if the described impairment in insulin signaling was a direct consequence of the elevated GH and IGF-1 levels or secondary to the resulting hyperinsulinemia or other alterations that may arise in a context of chronic GH exposure. Therefore, to dissect the direct role of GH in the impairment of insulin signal transduction in the heart, and to further explore the molecular mechanisms involved, we evaluated the activation of insulin signaling using different models of exposure to GH: 1) transgenic mice overexpressing GH, with chronically elevated GH, IGF-1 and insulin circulating levels, 2) liver IGF-1-deficient mice, with chronically elevated GH and insulin levels but decreased IGF-1 circulating levels, 3) mice treated with GH for a short period of time, and 4) primary culture of rat cardiomyocytes incubated with GH.

Methods

A more detailed version of “Materials and methods” is available as supplementary data.

Animals

Transgenic mice overexpressing GH (GH-Tg) used in this work exhibit chronically elevated bovine GH (bGH) and IGF-1 circulating levels, significantly increased body weight and organomegaly. Female 3-4-month-old animals were used, normal littermates served as controls. Mouse generation, breeding, housing and feeding were previously described (McGrane et al. 1988; Miquet et al. 2013).

The generation of liver-IGF-1-deficient (LID) mice, animal husbandry and PCR genotyping were already described (Yakar et al. 1999; Fernández et al. 2012). These animals have a 75% reduction in circulating IGF-1 levels, with a concomitant increase in GH levels, but exhibit normal growth and development. Mice that do not express the Cre transgene were used as controls. Female mice (2-4 months old) were used. Considering the well-known sexual dimorphism in many of GH actions (Liu et al. 2000; Tang et al. 2005), some determinations were also corroborated in males (i.e., body and heart weights, glucose levels, and Akt phosphorylation and protein content).

For short-term GH treatment, female Swiss-Webster mice (2-3 months old) were used. Mice received porcine GH (Zamira Life Sciences, Knoxfield, Victoria, Australia) for four days (2mg/kg/day) by two daily subcutaneous injections, control animals received saline (vehicle). Animal housing and feeding were as described (Bacigalupo et al. 2019).

All animal procedures were approved by the Laboratory Animal Care and Use Committee of the Southern Illinois University School of Medicine (GH-Tg mice) or of the School of Pharmacy and Biochemistry of the University of Buenos Aires (LID and Swiss-Webster mice, and neonatal rats), and complied with the Guidelines for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication, 8th Edition, 2011).

Primary culture of rat cardiomyocytes treated with GH

The isolation of neonatal cardiomyocytes from Sprague-Dawley rats was performed as reported (Santos et al. 2014). Isolated cardiomyocytes were incubated with DMEM-F12 containing 10% FBS for 24 h, then it was replaced with the same fresh medium with or without 1 μg/mL porcine GH. After 24 h, cells were incubated in the absence of serum in DMEM-F12 with or without GH for 6 h. For insulin stimulation experiments, after the 6 h incubation in the absence of serum, cells were incubated in DMEM-F12 with or without 10−5 M porcine insulin (Sigma, St. Louis, MO, USA) for 10 min. Cells were washed with cold phosphate buffer and stored at −70°C.

Acute insulin stimulation and tissue collection in animal models

Mice were fasted for 6 h, anesthetized with ketamine/xylazine mixture, and injected via the inferior cava vein with porcine insulin (10 IU/kg) in saline solution (0.9% w/v NaCl). To evaluate basal conditions, control mice were exposed to the same procedure but received vehicle. Five min after injection, the heart was removed, frozen, and kept at −70°C. Additional mice were subjected to a similar procedure but blood was extracted from the cava vein and the heart was removed and kept frozen at −70°C or fixed in 10% v/v formalin and embedded in paraffin for histological analysis.

Histological examination

Tissue sections were deparaffinized, subjected to Masson’s trichrome staining, and examined for myocardial fibrosis using a light microscope (DM2000, Leica Microsystems, Wetzlar, Germany). Photomicrographs were obtained by a Leica DFC400 digital camera.

Glucose, insulin, cholesterol, and triglyceride measurements

Glucose levels were measured in blood using the hand-held glucometer Presto Blood Glucose Meter (AgaMatrix, Salem, NH, USA) for GH-Tg mice or the ACCU-CHEK®Nano meter (Roche Diagnostics Corp., IN, USA) for LID and Swiss-Webster mice. Serum insulin levels were determined using the Rat/mouse insulin ELISA kit cat# EZRMI-13K, EMD Millipore (Billerica, MA, USA). Circulating cholesterol and triglyceride concentrations were measured by enzymatic colorimetric assay kits from Pointe Scientific (Canton, MI, USA).

Tissue and cell solubilization

Entire heart or cardiomyocytes were processed as previously described (Miquet et al. 2011; Santos et al. 2014). Protein concentration was determined using the BCA protein assay (Thermo Scientific Pierce, Rockford, IL, USA) and samples were subjected to ELISA or immunoblotting.

ELISA for IRS1 Ser307 phosphorylation determination

IRS1 phospho-Ser307 levels were measured using the PathScan® Phospho-IRS-1 (Ser307) Sandwich ELISA Kit (7287S) from Cell Signaling Technology Inc. (Danvers, MA, USA).

Immunoblotting

Equal amounts of total protein in solubilized samples were subjected to SDS-PAGE and immunoblotting as previously described (Bacigalupo et al. 2019). Protein loading control was performed by relativizing protein content to β-actin, β-tubulin or Coomassie blue staining of PVDF membranes after blotting experiments (Welinder and Ekblad 2011; Bacigalupo et al. 2019). Antibodies used for immunoblotting are displayed in Table 1.

Table 1.

List of antibodies. Antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA), Upstate Biotechnology (Lake Placid, NY, USA), EMD Millipore Corporation (Temecula, CA, USA), Abcam Inc. (Cambridge, MA, USA), Sigma-Aldrich (St. Louis, MO, USA) and Cell Signaling Technology Inc. (Danvers, MA, USA).

Antibody anti- target protein Company Catalog No.
IR β subunit Santa Cruz Biotechnology, Inc. sc-711
p38α MAPK Santa Cruz Biotechnology, Inc. sc-535
phospho-p38 MAPK Thr180/Tyr182 Santa Cruz Biotechnology, Inc. sc-17852-R
phospho-IRS1/2 Tyr612 Santa Cruz Biotechnology, Inc. sc-17195-R
GLUT4 Santa Cruz Biotechnology, Inc. sc-53566
p85 subunit of PI3K Millipore 06-496
phospho-IR Tyr972 Millipore 07-838
phospho-IR/IGF-1R Tyr1158/Tyr1162/Tyr1163 Millipore 07-841
β-tubulin Abcam Inc. Ab6046
β-actin Sigma-Aldrich A2066
phospho-Akt Ser473 Cell Signaling Technology Inc. 4060
phospho-Akt Thr308 Cell Signaling Technology Inc. 9275
Akt Cell Signaling Technology Inc. 4691
phospho-mTOR Ser2448 Cell Signaling Technology Inc. 2971
mTOR Cell Signaling Technology Inc. 2983
p44/42 MAP kinase (Erk1/2) Cell Signaling Technology Inc. 9102
phospho-p44/42 MAP kinase Thr202/Tyr204 (pErk1/2) Cell Signaling Technology Inc. 4370
phospho-GSK3β Ser9 Cell Signaling Technology Inc. 9323
GSK3β Cell Signaling Technology Inc. 9315
phospho-IRS1 Ser636/639 Cell Signaling Technology Inc. 2388
phospho-IRS1 Ser612 Cell Signaling Technology Inc. 2386
IRS1 Cell Signaling Technology Inc. 2382
phospho-AS160 Thr642 Cell Signaling Technology Inc. 4288
AS160 Cell Signaling Technology Inc. 2670
rabbit IgG (HRP-linked secondary antibody) Cell Signaling Technology Inc. 7074
mouse IgG (HRP-linked secondary antibody) Cell Signaling Technology Inc. 7076
Open in a new tab

Quantitative reverse transcriptase PCR (RT-qPCR)

Total RNA was extracted from heart tissue and qPCR reaction was performed as previously described (Piazza et al. 2017; Bacigalupo et al. 2019). Primer sequences are available in Table 2. Relative gene expression levels were calculated by the comparative cycle threshold (Ct) method (Pfaffl 2001). Target gene relative expression levels were normalized by the geometric mean of the four housekeeping genes used: Cyclophilin A, 18 S ribosomal RNA, β-actin and β-2 microglobulin (Vandesompele et al. 2002).

Table 2.

List of primers. Primers were obtained from Integrated DNA Technologies Inc. (Coralville, IA, USA) and from Invitrogen TM (Carlsbad, CA, USA).

Target gene Forward (5′-3′) Reverse (5′-3′)
GHR CCAACTCGCCTCTACACCG GGGAAAGGACTACACCACCTG
IGF-1R TGCCAGTGAGGTTGAAGTAA CGAGCCTTTTGACTTTTGTT
IGF-1 CCAAACACAATTCTCCTTCC GCTACAGCAACCTGTGATTG
GLUT4 TCCAGTATGTTGCGGATGCT GCAGGAGGACGGCAAATAGA
Cyclophilin A GCGTCTCCTTCGAGCTGTT AAGTCACCACCCTGGCAC
18 S rRNA ACGGACAGGATTGACAGATT GCCAGAGTCTCGTTCGTTAT
β-actin GTGCCCATCTACGAGGGCTATGCT TACCCAAGAAGGAAGGCTGGAAAA
β-2 microglobulin AAGTATACTCACGCCACCCA AAGACCAGTCCTTGCTGAAG
SOCS3 CTAGGTGAGGAGTGGTGGCT CTGCGAGGTTTCATTAGCTG
Open in a new tab

Statistical analysis

Experiments were performed analysing all groups of each experimental model in parallel. Results are expressed as mean ± SEM of the indicated number (n) of different individuals per group. In the case of cell culture, n refers to the number of wells for each experimental condition, the number of independent experiments is also indicated. Two-way ANOVA followed by the Bonferroni post-test or unpaired Student’s t-test were performed, data were considered significantly different if P<0.05.

Results

Animal characteristics

GH-Tg mice exhibited increased body weight and cardiomegaly, evidenced by the higher heart weight relative to the body weight, hyperinsulinemia with normoglycemia, and elevated circulating levels of total cholesterol and triglycerides (Table 3). For LID mice, determinations were performed in females, and some of them were also carried out in males to compare results of both sexes. Liver-specific deletion of the igf-1 gene was reported to have little or no effect on femur length and body and organ weights (Yakar et al. 1999), although the age-related gain in body weight after puberty was slowed in male LID mice (Yakar et al. 2009). As shown in Table 4, body weight in LID mice was reduced in males but increased in females, and cardiomegaly was not observed in either sex. Circulating glucose, insulin, triglyceride, and cholesterol levels were significantly increased in LID mice. Finally, GH-treated mice did not exhibit cardiomegaly and only presented elevated circulating cholesterol levels (Table 5).

Table 3.

Body and heart weights and circulating levels of glucose, insulin, triglycerides, and cholesterol in 3-4-month-old female transgenic mice overexpressing GH (GH-Tg) and normal controls. Data are the mean ± SEM of the indicated number (n) of different individuals per group. * P<0.01 vs. normal mice.

Normal GH-Tg
Body weight (BW) (g) 25.1 ± 0.6 (8) 41 ± 1 (8) *
Heart weight (HW) (g) 0.106 ± 0.003 (8) 0.206 ± 0.009 (8) *
HW/BW (%) 0.43 ± 0.01 (8) 0.50 ± 0.02 (8) *
Glucose (mg/dL) 133 ± 7 (8) 131 ± 8 (8)
Insulin (ng/mL) 0.16 ± 0.02 (7) 0.8 ± 0.2 (9) *
Triglycerides (mg/dL) 57 ± 9 (7) 131 ± 16 (8) *
Total cholesterol (mg/dL) 88 ± 7 (8) 253 ± 18 (7) *
Open in a new tab

Table 4.

Body and heart weights and circulating levels of glucose, insulin, triglycerides, and cholesterol in 2-4-month-old liver IGF-1-deficient (LID) mice and normal controls. Data are the mean ± SEM of the indicated number (n) of different individuals per group. * P<0.05 between LID and normal mice, # P<0.05 between females and males of the same genotype (i.e., normal or LID). ND: not determined.

Normal females LID females Normal males LID males
Body weight (BW) (g) 15.4 ± 0.5 (17) 18.0 ± 0.6 (17) * 24 ± 2 # (8) 20 ± 1 * (7)
Heart weight (HW) (g) 0.076 ± 0.003 (17) 0.080 ± 0.008 (17) 0.100 ± 0.006 # (8) 0.090 ± 0.005 (7)
HW/BW (%) 0.50 ± 0.02 (17) 0.45 ± 0.06 (17) 0.41 ± 0.01 # (8) 0.44 ± 0.01 (7)
Glucose (mg/dL) 164 ± 6 (17) 234 ± 7 (15) * 151 ± 21 (4) 261 ± 17 (3) *
Insulin (ng/mL) 0.12 ± 0.03 (9) 0.35 ± 0.08 (13) * ND ND
Triglycerides (mg/dL) 77 ± 5 (10) 161 ± 15 (13) * ND ND
Total cholesterol (mg/dL) 75 ± 5 (10) 100 ± 4 (13) * ND ND
Open in a new tab

Table 5.

Body and heart weights and circulating levels of glucose, insulin, triglycerides and cholesterol in 2-3-month-old female Swiss-Webster mice treated with GH (2mg/kg/day, administered in two daily subcutaneous injections) or controls that received saline. Data are the mean ± SEM of the indicated number (n) of different individuals per group. * P<0.05 vs saline controls.

Control mice GH-treated mice
Body weight (BW) (g) 29.0 ± 0.6 (8) 29.5 ± 0.6 (8)
Heart weight (HW) (g) 0.123 ± 0.002 (8) 0.127 ± 0.003 (8)
HW/BW (%) 0.42 ± 0.01 (8) 0.43 ± 0.01 (8)
Glucose (mg/dl) 107 ± 7 (9) 118 ± 5 (9)
Insulin (ng/ml) 0.4 ± 0,1 (6) 0.6 ± 0,1 (9)
Triglycerides (mg/dl) 66 ± 4 (9) 70 ± 5 (10)
Total Cholesterol (mg/dl) 84 ± 5 (9) 110 ± 4 (10) *
Open in a new tab

For the animal models of chronic exposure to high GH levels, histological analysis with Masson’s trichrome staining was performed to evaluate myocardial fibrosis. Perivascular and interstitial fibrosis was detected in GH-Tg mice (Supplementary Fig. 1A), but not in LID mice (Supplementary. Fig. 1B).

Activation of insulin signaling in mouse models

Insulin induced a marked phosphorylation of IR on Tyr972, IRS1/2 on Tyr612 and Akt on Thr308 in normal mice, but GH-Tg mice exhibited a lower response (Fig. 1A-C). Insulin-induced phosphorylation of the Akt substrates GSK3β at Ser9 and AS160 at Thr642 was blunted in GH-Tg mice as well (Fig. 1D-E). Signaling-mediator protein content was not significantly different among the experimental groups (Fig. 1A-E).

Figure 1. Activation of insulin signaling in the heart of GH-Tg mice.

Figure 1.

Open in a new tab

Normal (N) and GH-Tg (T) female mice were injected with saline (−) or insulin (+) and the heart was removed after 5 min. Equal amounts of solubilized heart protein were subjected to immunoblotting using specific antibodies to detect IR phosphorylation at Y972 and protein content (A), IRS1/2 phosphorylation at Y612 and IRS1 protein content (B), Akt phosphorylation at T308 and protein content (C), GSK3β phosphorylation at S9 and protein content (D), AS160 phosphorylation at T642 and protein content (E) and mTOR phosphorylation at S2448 and protein content (F). β-tubulin was used to control protein loading. Data are the mean ± SEM of five to seven different individuals per group. Groups denoted by different letters are significantly different (P<0.05), assessed by two-way ANOVA followed by Bonferroni post-test. NS: not significant. Representative immunoblots are shown.

Many growth factors and hormones, including insulin, induce phosphorylation of the Ser/Thr kinase mammalian target of rapamycin (mTOR) via the PI3K/Akt signaling pathway (Boucher et al. 2014; Yao and Han 2014; Yoon 2017). mTOR phosphorylation at Ser2448 was not significantly increased upon insulin stimulation, neither in normal nor in GH-Tg mice, the protein content did not exhibit differences either (Fig. 1F). A tendency towards higher mTOR basal phosphorylation levels in GH-Tg mice was observed, albeit statistical significance was not achieved when the four experimental groups were analyzed in parallel (Fig. 1F).

To better evaluate the differences in the basal phosphorylation levels of the signaling mediators, additional immunoblotting assays were performed in which non-stimulated normal and GH-Tg mice were run in parallel. GH-Tg mice displayed higher basal phosphorylation of IR (Fig. 2A), but this was not accompanied by higher phosphorylation of downstream signaling mediators including IRS1/2 (Tyr612), Akt (Thr308), GSK3β (Ser9) or AS160 (Thr642) (Fig. 2B-E). However, significantly higher mTOR basal phosphorylation at Ser2448 was detected in GH-Tg mice than in normal controls (Fig. 2F).

Figure 2. Basal phosphorylation of insulin signaling mediators in the heart of GH-Tg mice.

Figure 2.

Open in a new tab

Equal amounts of solubilized heart protein from normal (N) and GH-Tg (T) female mice were subjected to immunoblotting using specific antibodies to detect the phosphorylation of IR at Y972 (A), IRS1/2 at Y612 (B), Akt at T308 (C), GSK3β at S9 (D), AS160 at T642 (E) and mTOR at S2448 (F). β-tubulin was used to control protein loading. Data are the mean ± SEM of six to seven different individuals per group. Groups denoted by different letters are significantly different (P<0.05), assessed by Student’s t test. NS: not significant. Representative immunoblots are shown. Discontinuous lanes in the image indicate blot splicing, performed when the most representative samples of the two experimental groups shown in the graph were not run in contiguous lanes

In LID mice, the same determinations than those described for GH-Tg mice were performed, in addition, phosphorylation of IR on Tyr1158/Tyr1162/Tyr1163 and Akt on Ser473 was also assessed. In this model, insulin-induced phosphorylation of IR, IRS1/2, Akt, GSK3β and AS160 was also impaired, with a lower response in LID mice than in normal animals (Fig. 3A-E). No significant differences were detected among experimental groups for mTOR phosphorylation, albeit a clear tendency towards higher levels in the insulin-stimulated normal mice group was observed (Fig. 3F), or for the protein content of the mediators assessed (Fig. 3A-F). Insulin-induced Akt phosphorylation was lower in LID than in normal mice in males as well (Supplementary Fig. 2).

Figure 3. Activation of insulin signaling in the heart of LID mice.

Figure 3.

Open in a new tab

Normal (N) and LID (L) female mice were injected with saline (−) or insulin (+) and the heart was removed after 5 min. Equal amounts of solubilized heart protein were subjected to immunoblotting using specific antibodies to detect IR phosphorylation at Y972 and Y1158/Y1162/Y1163 and protein content (A), IRS1/2 phosphorylation at Y612 and IRS1 protein content (B), Akt phosphorylation at S473 and T308 and protein content (C), GSK3β phosphorylation at S9 and protein content (D), AS160 phosphorylation at T642 and protein content (E) and mTOR phosphorylation at S2448 and protein content (F). β-tubulin or Coomassie blue staining (CBS) of PVDF membranes were used to control protein loading. Data are the mean ± SEM of seven to eleven different individuals per group. Groups denoted by different letters are significantly different (P<0.05), assessed by two-way ANOVA followed by Bonferroni post-test. NS: not significant. Representative immunoblots are shown.

Mice treated with GH also displayed significantly reduced phosphorylation after insulin stimulation of IR, Akt, GSK3β and AS160 in comparison with animals that were not treated with GH (Fig. 4A, C-D). For IRS1/2, the same tendency was observed but differences did not reach statistical significance (Fig. 4B). In the case of mTOR, insulin induced a significant increase in its phosphorylation in mice that did not receive GH, while the increase was not significant in the GH-treated group (Fig. 4E).

Figure 4. Activation of insulin signaling in the heart of GH-treated mice.

Figure 4.

Open in a new tab

Female Swiss-Webster mice were treated with GH (2 mg/kg/day administered in two daily subcutaneous injections) for four days, control animals received saline solution (−). Six h after the last GH administration, mice were injected with saline (−) or insulin (Ins) and the heart was removed after 5 min. Equal amounts of solubilized heart protein were subjected to immunoblotting using specific antibodies to detect IR phosphorylation at Y972 and protein content (A), IRS1/2 phosphorylation at Y612 and IRS1 protein content (B), Akt phosphorylation at T308 and protein content (C), GSK3β phosphorylation at S9 and protein content (D), AS160 phosphorylation at T642 and protein content (E) and mTOR phosphorylation at S2448 and protein content (F). β-tubulin was used to control protein loading. Data are the mean ± SEM of five to eight different individuals per group. Groups denoted by different letters are significantly different (P<0.05), assessed by two-way ANOVA followed by Bonferroni post-test. NS: not significant. Representative immunoblots are shown. −/−: control saline treated mice, acute injection with saline; −/Ins: control saline treated mice, acute injection with insulin; GH/−: GH-treated mice, acute injection with saline; GH/Ins: GH-treated mice, acute injection with insulin.

LID mice displayed higher basal phosphorylation of IR (Tyr972) and mTOR (Ser2448), with no differences for IRS1/2 (Tyr612), Akt (Ser473), GSK3β (Ser9) and AS160 (Thr642) (Fig. 5A-F), compared with normal controls. In the case of GH-treated mice, a significant increase in the phosphorylation levels upon GH administration was detected only for mTOR (Fig. 5 G-L).

Figure 5. Basal phosphorylation of insulin signaling mediators in the heart of LID and GH-treated mice.

Figure 5.

Open in a new tab

Basal phosphorylation of insulin signaling mediators in the heart of normal (N) and LID (L) female mice is depicted in panels A to F. Results for female Swiss-Webster mice treated with GH (2 mg/kg/day in two daily subcutaneous injections) for four days, and the corresponding control animals that received saline (−), are shown in panels G to L. Equal amounts of solubilized heart protein were subjected to immunoblotting using specific antibodies to detect the phosphorylation of IR at Y972 (A, G), IRS1/2 at Y612 (B, H), Akt at S473 (C, I), GSK3β at S9 (D, J), AS160 at T642 (E, K) and mTOR at S2448 (F, L), as well as their protein content. β-tubulin, β-actin or Coomassie blue staining (CBS) of PVDF membranes were used to control protein loading. Data are the mean ± SEM of six to eleven different individuals per group. Groups denoted by different letters are significantly different (P<0.05), assessed by Student’s t test. NS: not significant. Representative immunoblots are shown. Discontinuous lanes in the image indicate blot splicing, performed when the most representative samples of the two experimental groups shown in the graph were not run in contiguous lanes

The protein content of the p85 subunit of PI3K was also determined in LID and GH-treated mice, and no differences were detected among mice exposed to elevated GH levels and their corresponding controls (Supplementary Fig. 3).

MAPKs phosphorylation and protein levels in mouse models

GH-Tg mice displayed higher basal phosphorylation of p38 at Thr180Tyr182, while no significant differences were detected for Erk1/2 at Thr202Tyr204 (Fig. 6A-B). LID mice displayed higher basal phosphorylation of both Erk1/2 and p38 than normal controls (Fig. 6C-D), while GH treatment was not associated with changes in their phosphorylation (Fig. 6E-F). The protein levels of Erk1/2 and p38 did not significantly vary among experimental groups in any of the models.

Figure 6. Basal phosphorylation and protein content of p38 and Erk1/2 in the heart of GH-Tg, LID and GH-treated mice.

Figure 6.

Open in a new tab

Results corresponding to GH-Tg (T) and their normal controls (N) are shown in panels A and B; those from LID (L) and their normal controls (N) are displayed in panels C and D. Results for female Swiss-Webster mice treated with GH (2 mg/kg/day in two daily subcutaneous injections) for four days, and the corresponding control animals that received saline (−), are shown in panels E and F. Equal amounts of solubilized heart protein from female mice were subjected to immunoblotting using specific antibodies to detect the phosphorylation of Erk1/2 at T202Y204 and its protein content (A, C, E), and the phosphorylation of p38 at T180Y182 (B, D, F). β-tubulin or β-actin were used to control protein loading. Data are the mean ± SEM of five to seven (A-B), ten to eleven (C-D) and nine to ten (E-F) different individuals per group. Groups denoted by different letters are significantly different (P<0.05), assessed by Student’s t test. NS: not significant. Representative immunoblots are shown.

IRS1 serine phosphorylation in mouse models

The phosphorylation of IRS1 at Ser307, which is considered an inhibitory modification, was elevated in GH-Tg (Fig. 7A), decreased in LID (Fig. 7B), and did not vary in GH-treated (Fig. 7C) mice. No changes were found either in the phosphorylation of IRS1 on Ser636/639 in GH-treated mice (Fig. 7D).

Figure 7. IRS1 serine phosphorylation and SOCS3 and GLUT4 expression in the heart of GH-Tg, LID and GH-treated mice.

Figure 7.

Open in a new tab

The serine phosphorylation of IRS1 and the mRNA content of SOCS3 and GLUT4 were assessed in female GH-Tg (T), LID (L) mice and their normal controls (N), and in Swiss-Webster mice treated with GH (2 mg/kg/day in two daily subcutaneous injections) for four days, and the corresponding control animals that received saline (−). Equal amounts of solubilized heart protein were subjected to an ELISA assay to determine IRS1 phosphorylation at S307 in GH-Tg (A), LID (B) and GH-treated mice (C). For GH-treated mice, IRS1 phosphorylation at S636/639 was also determined by immunoblotting, as well as its protein content (D). SOCS3 expression was assessed by RT-qPCR in GH-Tg (E), LID (F) and GH-treated mice (G). GLUT4 expression was evaluated by RT-qPCR in GH-Tg (H), LID (I) and GH-treated mice (J), and by the determination of its protein content by immunblotting in LID (K) and GH-treated mice (L). β-actin or β-tubulin were used to control protein loading, representative immunoblots are shown. The target gene relative expression mRNA levels in RT-qPCR experiments were normalized by the geometric mean of four housekeeping genes: Cyclophilin A, 18 S ribosomal RNA, β-actin, and β-2 microglobulin. Data are the mean ± SEM of different individuals per group (6 for ELISA for GH-Tg mice, 15 to 20 for ELISA for LID and GH-treated mice, 5 to 10 for immunoblotting and 10 for RT-qPCR). Groups denoted by different letters are significantly different (P<0.05), assessed by Student’s t test. NS: not significant.

SOCS3 expression in mouse models

The suppressor of cytokine signaling SOCS3 was reported to be induced by GH and to negatively modulate insulin signaling (Dominici et al. 2005). Nonetheless, SOCS3 mRNA cardiac content was unexpectedly decreased in GH-Tg mice (Fig. 7E) and not different in LID and GH-treated mice compared to control mice (Fig. 7F-G).

GLUT4 expression in mouse models

GH-Tg mice displayed significantly lower mRNA levels of the glucose transporter GLUT4 than normal controls (Fig. 7H). In contrast, GLUT4 expression in LID and GH-treated animals was not significantly different than in control mice, as assessed by its mRNA levels (Fig. 7I-J) and protein content (Fig. 7K-L).

GHR, IGF-1R and IGF-1 expression in mouse models

Cardiac mRNA content of GHR was lower in GH-Tg mice than in normal controls (Fig. 8A), while no differences were detected for LID or GH-treated mice (Fig. 8B-C). IGF1R mRNA levels also decreased in GH-Tg mice (Fig. 8D), but they were not altered in LID mice (Fig. 8E) and were increased in GH-treated animals (Fig. 8F). Finally, local expression of IGF-1 was higher in GH-Tg (Fig. 8G) and GH-treated animals (Fig. 8I) while it was not significantly different in LID mice compared with controls (Fig. 8H).

Figure 8. GHR, IGF-1R and IGF-1 expression in the heart of GH-Tg, LID and GH-treated mice.

Figure 8.

Open in a new tab

The cardiac expression of GHR, IGF-1R and IGF-1 was assessed by RT-qPCR in female GH-Tg (T), LID (L) mice and their normal controls (N), and in Swiss-Webster mice treated with GH (2 mg/kg/day in two daily subcutaneous injections) for four days, and the corresponding control animals that received saline (−). The target gene relative expression mRNA levels were normalized by the geometric mean of four housekeeping genes: Cyclophilin A, 18 S ribosomal RNA, β-actin and β-2 microglobulin. Data are the mean ± SEM of seven to eleven different individuals per group. Groups denoted by different letters are significantly different (P<0.05), assessed by Student’s t test. NS: not significant.

Insulin signaling in cardiomyocytes in culture

Insulin signaling was also evaluated in primary culture of rat cardiomyocytes. Incubation with GH resulted in an impaired response to acute insulin stimulation (Fig. 9) and increased IRS1 Ser307 phosphorylation (Fig. 10A). The protein levels of GLUT4 did not change upon GH exposure (Fig. 10B).

Figure 9. Activation of insulin signaling in primary culture of rat cardiomyocytes incubated with GH.

Figure 9.

Open in a new tab

Cardiac myocytes were incubated with GH (1 μg/mL) for 24 h prior to stimulation with insulin (10−5 M) for 10 min. Equal amounts of solubilized cell protein were subjected to immunoblotting using specific antibodies to determine IR phosphorylation at Y972 and protein content (A), IRS1/2 phosphorylation at Y612 and IRS1 protein content (B), Akt phosphorylation at S473 and protein content (C), GSK3β phosphorylation at S9 and protein content (D), AS160 phosphorylation at T642 and protein content (E) and mTOR phosphorylation at S2448 and protein content (F). β-tubulin or β-actin were used to control protein loading. Data are the mean ± SEM of three to seven independent experiments. Each experiment included two or three replicates per experimental group. Groups denoted by different letters are significantly different (P<0.05), assessed by two-way ANOVA followed by Bonferroni post-test. NS: not significant. Representative immunoblots are shown. −/−: control cells that were not incubated with GH or insulin; −/Ins: cells that were not incubated with GH but were stimulated with insulin; GH/−: cells that were incubated with GH but were not stimulated with insulin; GH/Ins: cells that were incubated with GH and stimulated with insulin.

Figure 10. IRS1 serine phosphorylation and GLUT4 expression in primary culture of rat cardiomyocytes incubated with GH.

Figure 10.

Open in a new tab

Cardiac myocytes were incubated with GH (1 μg/mL) for 24 h. Cells incubated without GH were processed and analysed in parallel and used as controls (−). Equal amounts of solubilized cells protein were subjected to an ELISA assay to determine IRS1 phosphorylation at S307 (A) or to immunoblot analysis using specific antibodies to assess GLUT4 protein content (B). β-actin was used to control protein loading. Representative immunoblots are shown. Data are the mean ± SEM of seven samples analyzed in two independent ELISA experiments (A) and of three independent experiments (B). Groups denoted by different letters are significantly different (P<0.05), assessed by Student’s t test. NS: not significant.

Discussion

Acromegaly is frequently associated with cardiovascular risk factors, including hypertension and disorders of lipid and glucose metabolism; however, a direct action of elevated GH and IGF-1 levels in the heart is also recognized in the pathogenesis of acromegalic cardiomyopathy (Sharma et al. 2017; Colao et al. 2019). Considering the insulin resistance associated with prolonged exposure to GH (Kim and Park 2017; Vila et al. 2019) and that insulin exerts important actions in the heart (Abel et al. 2012), it is relevant to understand the alterations in insulin signaling that occur in the heart in conditions of GH excess, as they may play a role in cardiac pathology.

Overexpression of GH in transgenic mice leads to elevated circulating levels of GH, IGF-1 and insulin (Sotelo et al. 1998; Miquet et al. 2011). Despite hyperinsulinemia, these mice are normoglycemic, but exhibit alterations in the response of target tissues to insulin, reflecting an insulin-resistant state, and also present disturbed lipid metabolism (Bartke 2003; Kopchick et al. 2014). Previous studies from our group demonstrated that 7-8-month-old female GH-Tg mice display cardiomegaly, cardiac perivascular and interstitial fibrosis, increased systolic blood pressure and impaired insulin signaling in the heart (Miquet et al. 2011; Muñoz et al. 2014). Studies in another line of transgenic mice overexpressing bGH demonstrated cardiac hypertrophy and fibrosis, hypertension, and impairment of cardiac function and bioenergetics (Bollano et al. 2000; Bohlooly-Y et al. 2001; Bogazzi et al. 2008; Bogazzi et al. 2009).

The 3-4-month-old GH-Tg mice used in the present work exhibited cardiomegaly and myocardial fibrosis. These mice presented decreased GHR and IGF-1R mRNA content in the heart presumably as a compensatory mechanism for the high circulating levels of their ligands. However, despite lower GHR, we observed increased IGF-1 mRNA levels in the heart. Therefore, even when GHR gene expression is decreased, the high GH circulating levels results in overexpression of local and circulating IGF-1 that may play a role in the cardiac alterations in this model.

As GH-Tg mice display concomitant elevated GH, IGF-1 and insulin levels, other models of GH exposure were studied to better understand the mechanism involved in the cardiac alterations upon prolonged GH exposure. LID mice exhibit elevated GH levels but decreased circulating IGF-1 levels (Yakar et al. 1999). In this work we used 2-4-month-old LID mice, which did not exhibit cardiomegaly or cardiac fibrosis. These results together with those obtained for GH-Tg mice suggest that the elevated IGF-1 levels may have a critical role in the genesis of cardiomegaly. Importantly, many studies have failed to show a direct hypertrophic effect of GH on cardiomyocytes and support that IGF-1 per se is involved (Isgaard et al. 2015; Sharma et al. 2017; Colao et al. 2019).

Despite no signs of cardiac histopathology were detected in the 2-4-month-old LID mice in our current study, other reports using cardiomyocytes isolated from LID mice of the same age reported impaired contractile properties in these cells (Li et al. 2008; Ungvari and Csiszar 2012), but intracellular calcium homeostasis was not affected at this age in LID mice (Li et al. 2008). It is possible that the impaired insulin signaling found in these mice may play a role in the altered cardiomyocyte contractile function, since Akt was shown to modulate cardiac contractility (Condorelli et al. 2002). A study with adult-onset endocrine IGF-1 deficiency in mice proposed that impaired PI3K/Akt-mediated Nrf2 activation may promote oxidative stress and ROS-mediated cellular injury in vascular endothelial and smooth muscle cells (Bailey-Downs et al. 2012).

In contrast with results for GH-Tg mice, the mRNA cardiac levels of GHR, IGF-1R and IGF-1 were not altered in LID animals. GH-treated mice exhibited an increase in IGF-1R levels, but no changes were detected for GHR and IGF-1. Hence, the increased cardiac expression of IGF-1 and decreased expression of GHR and IGF-1R in GH-Tg mice may be a consequence of the chronic exposure to extremely high GH levels along with moderately elevated IGF-1 serum levels, which are not replicated in the other models.

LID mice displayed hyperinsulinemia but, in contrast to GH-Tg mice, this was accompanied by higher glucose levels than control mice. Hyperinsulinemia is believed to promote cardiac hypertrophy by over-activating insulin signaling in the heart (Bertrand et al. 2008). However, our current results in young adult LID mice indicate that additional mechanisms may be involved apart from the elevated insulin levels per se. As expected, short term GH treatment was not associated with cardiomegaly in Swiss-Webster mice, although a tendency towards higher mean insulin levels was observed.

Despite the differences in the development of cardiomegaly and in the metabolic alterations among the three mouse experimental models analysed, exposure to GH was consistently associated with a decreased response to acute insulin stimulation in the heart at the receptor level and through PI3K/Akt signaling pathway. Moreover, a blunted response to insulin stimulation of this pathway was also observed in cultured cardiomyocytes of neonatal rats incubated with GH. Our current results indicate that insulin-induced activation of IR, IRS1/2, Akt, GSK3β and AS160 is impaired in the heart of young adult GH-Tg mice, and similar results were found for the other models under study, confirming that exposure to GH impairs insulin signaling in the heart. Higher basal phosphorylation of IR at Tyr972 was detected in GH-Tg and LID mice, probably as a consequence of the hyperinsulinemia they exhibit, but not in GH-treated mice. However, basal phosphorylation of downstream signaling mediators including IRS1/2 (Tyr612), Akt, GSK3β and AS160 was not altered in any of the animal models. In older GH-Tg mice, cardiac insulin signaling was altered downstream of the receptor and higher activating basal phosphorylation of not only IR but also of IRS1 and Akt was observed (Miquet et al. 2011).

Insulin, as well as other growth factors, induces mTOR phosphorylation on Ser2448 via PI3K/Akt pathway. Acute insulin stimulation was associated with a subtle increase in mTOR phosphorylation only in the control group (i.e., not exposed to elevated GH) for the four experimental models analysed, although it did not reach statistical significance for the normal controls of GH-Tg and LID mice. Basal mTOR phosphorylation was augmented in the heart of mice exposed to GH, as evidenced by results for GH-Tg, LID and GH-treated mice. Higher basal mTOR phosphorylation in the heart of older GH-Tg mice was observed, albeit mTOR protein upregulation was found as well (Miquet et al. 2011).

Increased inhibitory Ser/Thr phosphorylation of IR and IRS is considered a mechanism that contributes to insulin resistance (Boucher et al. 2014). Prolonged exposure to insulin or IGF-1 resulted in IRS1 Ser/Thr phosphorylation with a decrease in Akt activity (Copps and White 2012; Yoneyama et al. 2018). Multiple Ser/Thr kinases that are activated through IR, IGF-1R and GHR, including Akt, GSK3β, mTOR, and Erk, were reported to directly phosphorylate IRS1 (Siddle 2011; Copps and White 2012; Carter-Su et al. 2016). Chronic mTOR activation is believed to participate in the development of insulin resistance via negative feedback through IRS1 Ser phosphorylation (Yoon 2017), it may directly catalyse IRS1 Ser phosphorylation or may act through its target kinase S6K (Copps and White 2012; Haeusler et al. 2018).

Many different IRS1 Ser phosphorylation sites have been described, but the best studied is Ser307, which is frequently used as evidence of insulin resistance; however, its inhibitory role is not clear and it was postulated that its increase may be associated with, but not cause, insulin resistance (Copps and White 2012; Boucher et al. 2014; Yoon 2017; Haeusler et al. 2018). In the current work higher IRS1 Ser307 phosphorylation levels were found in the heart of GH-Tg and in cultured cardiomyocytes incubated with GH; however, their levels were not affected in GH-treated mice and were unexpectedly decreased in LID mice. Hence, impaired insulin signaling in the heart as a consequence of prolonged GH exposure was not consistently associated with elevated levels of IRS1 Ser307 phosphorylation.

In humans, defective IRS1/PI3K/Akt signaling in muscle was correlated with increased basal Ser phosphorylation of IRS1 at mTOR target sites. In mouse models of obesity and insulin resistance, increased basal mTOR-S6K activation in metabolic tissues was detected, associated with a pronounced Ser phosphorylation of IRS1 (Copps and White 2012). In our previous work in older GH-Tg mice the phosphorylation of IRS1 at Ser612 and at Ser636/639 was assessed, and it was found to be higher in cardiac tissue of GH-Tg mice than in normal controls (Miquet et al. 2011). mTOR and Erk1/2 are implicated in the phosphorylation of those residues (Copps and White 2012). Erk1/2 was reported to play a major role in the phosphorylation of IRS1 at these Ser residues after short-term insulin treatment, while mTOR would have a prominent role in their phosphorylation after prolonged insulin stimulation (Gual et al. 2003). We reported that mTOR protein content and phosphorylation was upregulated in the heart of older GH-Tg mice, however, Erk1/2 phosphorylation and protein abundance were not different from normal controls (Miquet et al. 2011). The younger GH-Tg mice studied in the current work did not exhibit higher Erk1/2 phosphorylation levels either. Therefore, our studies indicate that GH-Tg mice exhibit increased phosphorylation of IRS1 at various Ser residues in cardiac tissue and mTOR is possibly implicated in this negative modification, since higher activation of this kinase was found in the heart of these mice. However, it is likely that other Ser/Thr kinases might be involved.

In contrast with results obtained for GH-Tg mice, Erk1/2 basal phosphorylation levels were higher in LID mice than in normal controls. The cause and the implications of this finding are not clear. Erk1/2 is considered a promotor of cardiac hypertrophy; however, distinct activation events are likely to play different roles and the exact role of Erk1/2 in the heart requires further investigation (Mutlak and Kehat 2015). Our findings do not support a role for Erk1/2 basal activation in the development of cardiac hypertrophy under prolonged exposure to high GH levels.

The p38 MAPKs are Ser/Thr kinases activated in response to various extracellular stimuli, including inflammatory cytokines and growth factors. Activation of p38 in cardiac tissue is believed to promote fibrosis but it would not be directly implicated in the promotion of hypertrophy in vivo (Muslin 2008; Yokota and Wang 2016; Romero-Becerra et al. 2020). In the current work we found elevated basal phosphorylation levels of p38α, the dominant isoform in the heart, in GH-Tg and LID mice, but not in GH-treated mice. The fibrosis detected in the heart of older GH-Tg mice was proposed to be associated with the increased activation of p38 they exhibit (Miquet et al. 2011). However, although this may be the case for GH-Tg mice since younger GH-Tg mice also present myocardial fibrosis, elevated p38α phosphorylation is not associated with cardiac fibrosis in LID mice, at least in young adults.

Chronic insulin exposure was shown to activate p38 and promote cardiac IRS1/2 degradation, resulting in reduced Akt phosphorylation, which may serve as a central mechanism for cardiac dysfunction during insulin resistance and type 2 diabetes (Qi et al. 2013). GH-Tg and LID mice are exposed to chronically elevated GH and insulin levels and exhibit higher basal activation of p38α in the heart, but IRS1 content was not altered. Therefore, even though p38α may play a role in the cardiac insulin resistance that these mice present, another mechanism not related to IRS degradation may be involved.

The suppressor of cytokine signaling (SOCS) proteins are induced by and regulate signalling of a great variety of cytokines, growth factors and hormones. SOCS1 and SOCS3 transcription is induced by GH and these proteins were shown to negatively modulate insulin signaling, leading to insulin resistance (Dominici et al. 2005; Boucher et al. 2014; Galic et al. 2014; Haeusler et al. 2018). SOCS3 mRNA content in the heart of mice exposed to GH was not increased, indicating that prolonged GH action is not associated with upregulation of SOCS3 in this tissue and, therefore, it would not be involved in the impaired insulin signaling observed.

We have previously reported that the protein content of GLUT4 was reduced in the heart of GH-Tg mice (Miquet et al. 2011), and in the current work we found that GLUT4 mRNA levels were reduced as well. However, GLUT4 expression was not altered in the heart of LID or GH-treated mice, neither in cardiomyocytes that were incubated with GH. Downregulation of GLUT4 is considered an early change in the evolution of insulin resistance in the heart and is associated with diabetes and cardiac hypertrophy (DeBosch and Muslin 2008; Abel et al. 2012; Shao and Tian 2015).

Another molecular mechanism described to impair insulin signaling is the upregulation of the p85 regulatory subunit of the PI3K (Dominici et al. 2005). However, our current and previous (Miquet et al. 2011) results show that exposure to GH is not associated with changes in the cardiac expression of p85α.

Alterations of insulin signaling in other tissues of GH-Tg (Dominici et al. 1999b, 1999a; Dominici et al. 2005) and LID (Yakar et al. 2001; Haluzik et al. 2003) mice were previously reported, but the molecular alterations seem to be tissue specific. Hyperinsulinemia is often associated with basal activation of the IR, but not always with receptor downregulation. In cardiac tissue, IR protein levels were not altered but basal phosphorylation was increased in GH-Tg and LID mice. Rats treated with GH exhibit impaired insulin activation of the IR/IRS/PI3K pathway and reduced IRS1 content, accompanied by increased Ser307 phosphorylation of IRS1, in liver, skeletal muscle and white adipose tissue (Prattali et al. 2005). Our current results in GH-treated mice indicate that insulin signaling is impaired in the heart, but this was not associated with enhanced Ser307-IRS1 phosphorylation, denoting, again, that the molecular mechanisms involved in GH-induced insulin resistance in the heart may be different from those found in other tissues.

In conclusion, impairment of insulin signaling in the heart appears to be a consistent finding associated with exposure to GH regardless of the concomitant increase in IGF-1 and insulin circulating levels. Moreover, it is an early event which is observed even in the absence of cardiac pathology, indicating that it is not secondary to the pathological alterations that may arise in the heart upon chronic exposure to high GH levels. However, considering the important functions of insulin in the heart, altered insulin signaling might play a role in the progress of the cardiac pathology. Prolonged exposure to GH in vivo was associated with increased basal phosphorylation of mTOR in the heart, suggesting that this Ser/Thr kinase may play an important role in the alterations observed in cardiac insulin signaling. Finally, this work points to the heart as another important tissue of GH-induced insulin resistance.

Supplementary Material

01

Supplementary Figure 1. Cardiac histology of GH-Tg and LID mice. Heart sections were stained with Masson’s trichrome and examined for myocardial fibrosis using a light microscope. The whole cardiac sections were observed and representative photomicrographs of GH-Tg (A) and LID (B) female mice, and the corresponding normal controls, are shown (original magnification 100X and 400X). Six individuals of each experimental group were analysed in parallel. Blue-stained regions corresponding to cardiac extracellular-matrix content is evidenced in GH-Tg mice.

Supplementary Figure 2. Activation of insulin signaling in the heart of LID mice. Normal (N) and LID (L) male mice were injected with saline (−) or insulin (+) and the heart was removed after 5 min. Equal amounts of solubilized heart protein were subjected to immunoblotting using specific antibodies to detect Akt phosphorylation at S473 and T308 and protein content. Coomassie blue staining (CBS) of PVDF membranes was used to control protein loading. Data are the mean ± SEM of five to seven different individuals per group. Groups denoted by different letters are significantly different (P<0.05), assessed by two-way ANOVA followed by Bonferroni post-test. NS: not significant. Representative immunoblots are shown.

Supplementary Figure 3. p85 protein content in the heart of LID and GH-treated mice. Protein content of p85 was assessed in the heart of normal (N) and LID (L) female mice (A) and of Swiss-Webster female mice treated with GH (2 mg/kg/day in two daily subcutaneous injections) for four days, the corresponding control animals received saline (−) (B). Mice were injected with saline (−) or insulin (Ins) and the heart was removed after 5 min. Equal amounts of solubilized heart protein were subjected to immunoblotting using specific antibodies to detect the p85 subunit of PI3K. β-tubulin was used to control protein loading. Data are the mean ± SEM of six to eleven different individuals per group. Two-way ANOVA followed by Bonferroni post-test was performed, a P value less than 0.05 was considered statistically significant. NS: not significant. Representative immunoblots are shown.

Supplementary Figure 4. Uncropped images from Western blots corresponding to heart extracts of GH-Tg mice.

Supplementary Figure 5. Uncropped images from Western blots corresponding to heart extracts of LID mice.

Supplementary Figure 6. Uncropped images from Western blots corresponding to heart extracts of GH-treated mice.

Supplementary Figure 7. Uncropped images from Western blots corresponding to cell lysates of primary culture of rat cardiomyocytes incubated with GH.

Acknowledgements

Financial support from the Universidad de Buenos Aires and the Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) of Argentina in the form of postgraduate or graduate studentships (to VGP, VB, NSC, CSM and NVM) is acknowledged.

Funding

This work was supported by the Universidad de Buenos Aires (grant numbers 20020170100551BA to AIS, 20020150200014BA to MCM), Agencia Nacional de Promoción Científica y Tecnológica (grant numbers PICT-2015-1100 and PICT2019-2019-00627 to JGM, PICT2019-2019-00051 to FPD), the Consejo Nacional de Investigaciones Científicas y Técnicas (grant number PIP 11220170100885 to PP), the Society for Endocrinology (Early Career Programme 2011 to JGM), and the National Institute on Aging of the National Institutes of Health (grant numbers R01AG019899, R21AG062985 to AB), and American Diabetes Association (grant number 119-IBS-126 to AB), and Agencia Nacional de Investigación y Desarrollo (ANID), Chile (grant numbers FONDAP 15130011 and FONDECYT 1200490 to SL)

Footnotes

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

References

  1. Abel ED, O'Shea KM & Ramasamy R 2012. Insulin resistance: metabolic mechanisms and consequences in the heart. Arterioscler Thromb Vasc Biol 32 2068–2076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bacigalupo ML, Piazza VG, Cicconi NS, Carabias P, Bartke A, Fang Y, Sotelo AI, Rabinovich GA, Troncoso MF & Miquet JG 2019. Growth hormone upregulates the pro-tumorigenic galectin 1 in mouse liver. Endocr Connect 8 1108–1117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bailey-Downs LC, Mitschelen M, Sosnowska D, Toth P, Pinto JT, Ballabh P, Valcarcel-Ares MN, Farley J, Koller A, Henthorn JC, et al. 2012. Liver-specific knockdown of IGF-1 decreases vascular oxidative stress resistance by impairing the Nrf2-dependent antioxidant response: a novel model of vascular aging. J Gerontol A Biol Sci Med Sci 67 313–329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bartke A 2003. Can growth hormone (GH) accelerate aging? Evidence from GH-transgenic mice. Neuroendocrinology 78 210–216. [DOI] [PubMed] [Google Scholar]
  5. Bertrand L, Horman S, Beauloye C & Vanoverschelde JL 2008. Insulin signalling in the heart. Cardiovasc Res 79 238–248. [DOI] [PubMed] [Google Scholar]
  6. Bogazzi F, Russo D, Raggi F, Ultimieri F, Urbani C, Gasperi M, Bartalena L & Martino E 2008. Transgenic mice overexpressing growth hormone (GH) have reduced or increased cardiac apoptosis through activation of multiple GH-dependent or -independent cell death pathways. Endocrinology 149 5758–5769. [DOI] [PubMed] [Google Scholar]
  7. Bogazzi F, Raggi F, Ultimieri F, Russo D, D-Alessio A, Manariti A, Brogioni S, Manetti L & Martino E 2009. Regulation of cardiac fatty acids metabolism in transgenic mice overexpressing bovine GH. J Endocrinol 201 419–427. [DOI] [PubMed] [Google Scholar]
  8. Bohlooly-Y M, Carlson L, Olsson B, Gustafsson H, Andersson IJ, Törnell J & Bergström G 2001. Vascular function and blood pressure in GH transgenic mice. Endocrinology 142 3317–3323. [DOI] [PubMed] [Google Scholar]
  9. Bollano E, Omerovic E, Bohlooly-y M, Kujacic V, Madhu B, Törnell J, Isaksson O, Soussi B, Schulze W, Fu ML, et al. 2000. Impairment of cardiac function and bioenergetics in adult transgenic mice overexpressing the bovine growth hormone gene. Endocrinology 141 2229–2235. [DOI] [PubMed] [Google Scholar]
  10. Boucher J, Kleinridders A & Kahn CR 2014. Insulin receptor signaling in normal and insulin-resistant states. Cold Spring Harb Perspect Biol 6 a009191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Carter-Su C, Schwartz J & Argetsinger LS 2016. Growth hormone signaling pathways. Growth Horm IGF Res 28 11–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Colao A, Grasso LFS, Di Somma C & Pivonello R 2019. Acromegaly and Heart Failure. Heart Fail Clin 15 399–408. [DOI] [PubMed] [Google Scholar]
  13. Condorelli G, Drusco A, Stassi G, Bellacosa A, Roncarati R, Iaccarino G, Russo MA, Gu Y, Dalton N, Chung C, et al. 2002. Akt induces enhanced myocardial contractility and cell size in vivo in transgenic mice. Proc Natl Acad Sci U S A 99 12333–12338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Copps KD & White MF 2012. Regulation of insulin sensitivity by serine/threonine phosphorylation of insulin receptor substrate proteins IRS1 and IRS2. Diabetologia 55 2565–2582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. DeBosch BJ & Muslin AJ 2008. Insulin signaling pathways and cardiac growth. J Mol Cell Cardiol 44 855–864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dominici FP, Cifone D, Bartke A & Turyn D 1999a. Loss of sensitivity to insulin at early events of the insulin signaling pathway in the liver of growth hormone-transgenic mice. J Endocrinol 161 383–392. [DOI] [PubMed] [Google Scholar]
  17. Dominici FP, Cifone D, Bartke A & Turyn D 1999b. Alterations in the early steps of the insulin-signaling system in skeletal muscle of GH-transgenic mice. Am J Physiol 277 E447–454. [DOI] [PubMed] [Google Scholar]
  18. Dominici FP, Argentino DP, Muñoz MC, Miquet JG, Sotelo AI & Turyn D 2005. Influence of the crosstalk between growth hormone and insulin signalling on the modulation of insulin sensitivity. Growth Horm IGF Res 15 324–336. [DOI] [PubMed] [Google Scholar]
  19. Fernández MC, Venara M, Nowicki S, Chemes HE, Barontini M & Pennisi PA 2012. Igf-I regulates pheochromocytoma cell proliferation and survival in vitro and in vivo. Endocrinology 153 3724–3734. [DOI] [PubMed] [Google Scholar]
  20. Galic S, Sachithanandan N, Kay TW & Steinberg GR 2014. Suppressor of cytokine signalling (SOCS) proteins as guardians of inflammatory responses critical for regulating insulin sensitivity. Biochem J 461 177–188. [DOI] [PubMed] [Google Scholar]
  21. Gual P, Grémeaux T, Gonzalez T, Le Marchand-Brustel Y & Tanti JF 2003. MAP kinases and mTOR mediate insulin-induced phosphorylation of insulin receptor substrate-1 on serine residues 307, 612 and 632. Diabetologia 46 1532–1542. [DOI] [PubMed] [Google Scholar]
  22. Haeusler RA, McGraw TE & Accili D 2018. Biochemical and cellular properties of insulin receptor signalling. Nat Rev Mol Cell Biol 19 31–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Haluzik M, Yakar S, Gavrilova O, Setser J, Boisclair Y & LeRoith D 2003. Insulin resistance in the liver-specific IGF-1 gene-deleted mouse is abrogated by deletion of the acid-labile subunit of the IGF-binding protein-3 complex: relative roles of growth hormone and IGF-1 in insulin resistance. Diabetes 52 2483–2489. [DOI] [PubMed] [Google Scholar]
  24. Isgaard J, Arcopinto M, Karason K & Cittadini A 2015. GH and the cardiovascular system: an update on a topic at heart. Endocrine 48 25–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kim SH & Park MJ 2017. Effects of growth hormone on glucose metabolism and insulin resistance in human. Ann Pediatr Endocrinol Metab 22 145–152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kopchick JJ, List EO, Kelder B, Gosney ES & Berryman DE 2014. Evaluation of growth hormone (GH) action in mice: discovery of GH receptor antagonists and clinical indications. Mol Cell Endocrinol 386 34–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Li Q, Ceylan-Isik AF, Li J & Ren J 2008. Deficiency of insulin-like growth factor 1 reduces sensitivity to aging-associated cardiomyocyte dysfunction. Rejuvenation Res 11 725–733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Liu JL, Yakar S & LeRoith D 2000. Mice deficient in liver production of insulin-like growth factor I display sexual dimorphism in growth hormone-stimulated postnatal growth. Endocrinology 141 4436–4441. [DOI] [PubMed] [Google Scholar]
  29. McGrane MM, de Vente J, Yun J, Bloom J, Park E, Wynshaw-Boris A, Wagner T, Rottman FM & Hanson RW 1988. Tissue-specific expression and dietary regulation of a chimeric phosphoenolpyruvate carboxykinase/bovine growth hormone gene in transgenic mice. J Biol Chem 263 11443–11451. [PubMed] [Google Scholar]
  30. Miquet JG, Giani JF, Martinez CS, Muñoz MC, González L, Sotelo AI, Boparai RK, Masternak MM, Bartke A, Dominici FP, et al. 2011. Prolonged exposure to GH impairs insulin signaling in the heart. J Mol Endocrinol 47 167–177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Miquet JG, Freund T, Martinez CS, González L, Díaz ME, Micucci GP, Zotta E, Boparai RK, Bartke A, Turyn D, et al. 2013. Hepatocellular alterations and dysregulation of oncogenic pathways in the liver of transgenic mice overexpressing growth hormone. Cell Cycle 12 1042–1057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Muñoz MC, Burghi V, Miquet JG, Giani JF, Banegas RD, Toblli JE, Fang Y, Wang F, Bartke A & Dominici FP 2014. Downregulation of the ACE2/Ang-(1–7)/Mas axis in transgenic mice overexpressing GH. J Endocrinol 221 215–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Muslin AJ 2008. MAPK signalling in cardiovascular health and disease: molecular mechanisms and therapeutic targets. Clin Sci (Lond) 115 203–218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mutlak M & Kehat I 2015. Extracellular signal-regulated kinases 1/2 as regulators of cardiac hypertrophy. Front Pharmacol 6 149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Olarescu NC & Bollerslev J 2016. The Impact of Adipose Tissue on Insulin Resistance in Acromegaly. Trends Endocrinol Metab 27 226–237. [DOI] [PubMed] [Google Scholar]
  36. Pfaffl MW 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29 e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Piazza VG, Bartke A, Miquet JG & Sotelo AI 2017. Analysis of Different Approaches for the Selection of Reference Genes in RT-qPCR Experiments: A Case Study in Skeletal Muscle of Growing Mice. Int J Mol Sci 18 1060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Prattali RR, Barreiro GC, Caliseo CT, Fugiwara FY, Ueno M, Prada PO, Velloso LA, Saad MJ & Carvalheira JB 2005. Aspirin inhibits serine phosphorylation of insulin receptor substrate 1 in growth hormone treated animals. FEBS Lett 579 3152–3158. [DOI] [PubMed] [Google Scholar]
  39. Qi Y, Xu Z, Zhu Q, Thomas C, Kumar R, Feng H, Dostal DE, White MF, Baker KM & Guo S 2013. Myocardial loss of IRS1 and IRS2 causes heart failure and is controlled by p38α MAPK during insulin resistance. Diabetes 62 3887–3900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Romero-Becerra R, Santamans AM, Folgueira C & Sabio G 2020. p38 MAPK Pathway in the Heart: New Insights in Health and Disease. Int J Mol Sci 21 7412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Santos SH, Giani JF, Burghi V, Miquet JG, Qadri F, Braga JF, Todiras M, Kotnik K, Alenina N, Dominici FP, et al. 2014. Oral administration of angiotensin-(1-7) ameliorates type 2 diabetes in rats. J Mol Med (Berl) 92 255–265. [DOI] [PubMed] [Google Scholar]
  42. Shao D & Tian R 2015. Glucose Transporters in Cardiac Metabolism and Hypertrophy. Compr Physiol 6 331–351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Sharma MD, Nguyen AV, Brown S & Robbins RJ 2017. Cardiovascular Disease in Acromegaly. Methodist Debakey Cardiovasc J 13 64–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Siddle K 2011. Signalling by insulin and IGF receptors: supporting acts and new players. J Mol Endocrinol 47 R1–10. [DOI] [PubMed] [Google Scholar]
  45. Sotelo AI, Bartke A, Kopchick JJ, Knapp JR & Turyn D 1998. Growth hormone (GH) receptors, binding proteins and IGF-I concentrations in the serum of transgenic mice expressing bovine GH agonist or antagonist. J Endocrinol 158 53–59. [DOI] [PubMed] [Google Scholar]
  46. Tang Z, Yu R, Lu Y, Parlow AF & Liu JL 2005. Age-dependent onset of liver-specific IGF-I gene deficiency and its persistence in old age: implications for postnatal growth and insulin resistance in LID mice. Am J Physiol Endocrinol Metab 289 E288–295. [DOI] [PubMed] [Google Scholar]
  47. Ungvari Z & Csiszar A 2012. The emerging role of IGF-1 deficiency in cardiovascular aging: recent advances. J Gerontol A Biol Sci Med Sci 67 599–610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A & Speleman F 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3 RESEARCH0034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Vila G, Jørgensen JOL, Luger A & Stalla GK 2019. Insulin Resistance in Patients With Acromegaly. Front Endocrinol (Lausanne) 10 509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Welinder C & Ekblad L 2011. Coomassie staining as loading control in Western blot analysis. J Proteome Res 10 1416–1419. [DOI] [PubMed] [Google Scholar]
  51. Yakar S, Liu JL, Stannard B, Butler A, Accili D, Sauer B & LeRoith D 1999. Normal growth and development in the absence of hepatic insulin-like growth factor I. Proc Natl Acad Sci U S A 96 7324–7329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yakar S, Liu JL, Fernandez AM, Wu Y, Schally AV, Frystyk J, Chernausek SD, Mejia W & Le Roith D 2001. Liver-specific igf-1 gene deletion leads to muscle insulin insensitivity. Diabetes 50 1110–1118. [DOI] [PubMed] [Google Scholar]
  53. Yakar S, Canalis E, Sun H, Mejia W, Kawashima Y, Nasser P, Courtland HW, Williams V, Bouxsein M, Rosen C, et al. 2009. Serum IGF-1 determines skeletal strength by regulating subperiosteal expansion and trait interactions. J Bone Miner Res 24 1481–1492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Yao H & Han X 2014. The cardioprotection of the insulin-mediated PI3K/Akt/mTOR signaling pathway. Am J Cardiovasc Drugs 14 433–442. [DOI] [PubMed] [Google Scholar]
  55. Yokota T & Wang Y 2016. p38 MAP kinases in the heart. Gene 575 369–376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yoneyama Y, Inamitsu T, Chida K, Iemura SI, Natsume T, Maeda T, Hakuno F & Takahashi SI 2018. Serine Phosphorylation by mTORC1 Promotes IRS-1 Degradation through SCFβ-TRCP E3 Ubiquitin Ligase. iScience 5 1–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Yoon MS 2017. The Role of Mammalian Target of Rapamycin (mTOR) in Insulin Signaling. Nutrients 9 1176. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

Supplementary Figure 1. Cardiac histology of GH-Tg and LID mice. Heart sections were stained with Masson’s trichrome and examined for myocardial fibrosis using a light microscope. The whole cardiac sections were observed and representative photomicrographs of GH-Tg (A) and LID (B) female mice, and the corresponding normal controls, are shown (original magnification 100X and 400X). Six individuals of each experimental group were analysed in parallel. Blue-stained regions corresponding to cardiac extracellular-matrix content is evidenced in GH-Tg mice.

Supplementary Figure 2. Activation of insulin signaling in the heart of LID mice. Normal (N) and LID (L) male mice were injected with saline (−) or insulin (+) and the heart was removed after 5 min. Equal amounts of solubilized heart protein were subjected to immunoblotting using specific antibodies to detect Akt phosphorylation at S473 and T308 and protein content. Coomassie blue staining (CBS) of PVDF membranes was used to control protein loading. Data are the mean ± SEM of five to seven different individuals per group. Groups denoted by different letters are significantly different (P<0.05), assessed by two-way ANOVA followed by Bonferroni post-test. NS: not significant. Representative immunoblots are shown.

Supplementary Figure 3. p85 protein content in the heart of LID and GH-treated mice. Protein content of p85 was assessed in the heart of normal (N) and LID (L) female mice (A) and of Swiss-Webster female mice treated with GH (2 mg/kg/day in two daily subcutaneous injections) for four days, the corresponding control animals received saline (−) (B). Mice were injected with saline (−) or insulin (Ins) and the heart was removed after 5 min. Equal amounts of solubilized heart protein were subjected to immunoblotting using specific antibodies to detect the p85 subunit of PI3K. β-tubulin was used to control protein loading. Data are the mean ± SEM of six to eleven different individuals per group. Two-way ANOVA followed by Bonferroni post-test was performed, a P value less than 0.05 was considered statistically significant. NS: not significant. Representative immunoblots are shown.

Supplementary Figure 4. Uncropped images from Western blots corresponding to heart extracts of GH-Tg mice.

Supplementary Figure 5. Uncropped images from Western blots corresponding to heart extracts of LID mice.

Supplementary Figure 6. Uncropped images from Western blots corresponding to heart extracts of GH-treated mice.

Supplementary Figure 7. Uncropped images from Western blots corresponding to cell lysates of primary culture of rat cardiomyocytes incubated with GH.

NIHMS1813926-supplement-01.docx (2.3MB, docx)

RESOURCES