| Reagent/Resource | Reference or Source | Identifier or Catalog Number |
|---|---|---|
| Experimental Models | ||
| Citrate‐treated peripheral blood (H. sapiens) | Institute of Transfusion Medicine, University Medical Center Hamburg‐Eppendorf, Hamburg, Germany | N/A |
| EDTA‐treated peripheral blood (H. sapiens) | Hamburger Gesundkohorte University Medical Center Hamburg‐Eppendorf, Hamburg, Germany | N/A |
| HEK293T/17 (H. sapiens) | ATCC | Cat#CRL‐11268; RRID:CVCL_1926 |
| LCL 721.221 (H. sapiens) | ATCC | Cat#CRL‐1855; RRID:CVCL_6263 |
| .221‐Cas9 | Generated in this study | N/A |
| .221‐DR4/5KO | Generated in this study | N/A |
| Raji (H. sapiens) | Ragon Institute of MGH, MIT and Harvard, Cambridge, MA, USA | RRID:CVCL_0511 |
| Raji‐pSIP | Generated in this study | N/A |
| Raji‐DR5++ | Generated in this study | N/A |
| pNL4‐3 | NIH HIV Reagent Program | Cat#ARP‐114 |
| pYK‐JRCSF | NIH HIV Reagent Program | Cat#ARP‐2708 |
| HIV‐1 WITO | Mary Carrington (National Cancer Institute); Ochsenbauer et al, 2012 | N/A |
| HIV‐1 CH198 | Beatrice Hahn (University of Pennsylvania); Parrish et al, 2013 | N/A |
| HIV‐1 CH236 | Beatrice Hahn (University of Pennsylvania); Fenton‐May et al, 2013 | N/A |
| Recombinant DNA | ||
| pLVX‐SIP | Ragon Institute of MGH, MIT and Harvard, Cambridge, MA, USA; Dr. Thomas Pertel | N/A |
| pCMV‐VSV‐G | Addgene | Cat#8454; RRID:Addgene_8454 |
| psPAX2 | NIH HIV Reagent Program | Cat#ARP‐11348; RRID:Addgene_12260 |
| plentiCas9‐Blast | Addgene | Cat#52962; RRID:Addgene_52962 |
| plentiGuide‐Puro encoding gRNA sequences | GenScript | Cat#SC1678 |
| Antibodies | ||
| Mouse α‐human CD3 PerCP‐Cy5.5 (clone UCHT1) | BioLegend | Cat#300430; RRID:AB_893299 |
| Mouse α‐human CD3 PE/Dazzle594 (clone UCHT1) | BioLegend | Cat#300450; RRID:AB_2563618 |
| Mouse α‐human CD3 BV421 (clone UCHT1) | BioLegend | Cat#300434; RRID:AB_10962690 |
| Mouse α‐human CD3 Pacific blue (clone UCHT1) | BD Biosciences | Cat#558117; RRID:AB_397038 |
| Mouse α‐human CD4 APC (clone RPA‐T4) | BD Biosciences | Cat#555349, RRID:AB_398593 |
| Mouse α‐human CD4 APC (clone OKT4) | BioLegend | Cat#317416; RRID:AB_571945 |
| Mouse α‐human CD4 BV711 (clone RPA‐T4) | BioLegend | Cat#300558, RRID:AB_2564393 |
| Mouse α‐human CD14 PerCP‐Cy5.5 (clone HCD14) | BioLegend | Cat#325622; RRID:AB_893250 |
| Mouse α‐human CD16 BV785 (clone 3G8) | BioLegend | Cat#302046; RRID:AB_2563803 |
| Mouse α‐human CD16 (clone 3G8) | BioLegend | Cat#302014; RRID:AB_314214 |
| Mouse α‐human CD19 PerCP‐Cy5.5 (clone HIB19) | BioLegend | Cat#302230; RRID:AB_2073119 |
| Mouse α‐human CD45 AF700 (clone 2D1) | BioLegend | Cat#368514; RRID:AB_2566374 |
| Mouse α‐human CD45 BV605 (clone 2D1) | BioLegend | Cat#368524; RRID:AB_2715826 |
| Mouse α‐human CD45 PerCP‐Cy5.5 (clone 2D1) | BioLegend | Cat#368503; RRID:AB_2566351 |
| Mouse α‐human CD56 BUV395 (clone NCAM16.2) | BD Biosciences | Cat#563554; RRID:AB_2687886 |
| Mouse α‐human CD57 PE/Dazzle594 (clone HNK‐1) | BioLegend | Cat#359620; RRID:AB_2564063 |
| Mouse α‐human CD107a BV510 (clone H4A3) | BioLegend | Cat#328632; RRID:AB_2562648 |
| Mouse α‐human KIR2DL1/S5 FITC (clone 143211) | R&D Systems | Cat#FAB1844F‐100; RRID:AB_2130402 |
| Mouse α‐human KIR2DL2/L3/S2 BV711 (clone DX27) | BD Biosciences | Cat#745442; RRID:AB_2742987 |
| Human α‐human NKG2C PE (clone REA205) | Miltenyi Biotec | Cat#130‐103‐635; RRID:AB_2655394 |
| Mouse α‐human KIR3DL1 BV421 (clone DX9) | BioLegend | Cat#312714; RRID:AB_2561652 |
| Mouse α‐human NKG2A PE‐Cy7 (clone Z199) | Beckman Coulter | Cat#B10246; RRID:AB_2687887 |
| Mouse α‐human CD253 (TRAIL) APC (clone RIK‐2.1) | Miltenyi Biotec | Cat#130‐097‐314; RRID:AB_2656681 |
| Mouse α‐human CD253 (TRAIL) (clone RIK‐2) | BioLegend | Cat#308214; RRID:AB_2814155 |
| Mouse α‐human TRAIL‐R1 (DR4) (clone HS101) | AdipoGen | Cat#AG‐20B‐0022PF; RRID:AB_2490215 |
| Mouse α‐human CD261 (DR4) Biotin (clone DJR1) | Miltenyi Biotec | Cat#130‐109‐084; RRID:AB_2656741 |
| Mouse α‐human TRAIL‐R2 (DR5) (clone HS201) | AdipoGen | Cat#AG‐20B‐0023; RRID:AB_2490218 |
| Mouse α‐human TRAIL‐R2 (DR5) (clone HS201) | AdipoGen | Cat#AG‐20B‐0023PF; RRID:AB_2490221 |
| Mouse α‐human CD262 (DR5) Biotin (clone DJR2‐4) | Miltenyi Biotec | Cat#130‐097‐303; RRID:AB_2656745 |
| α‐human TRAIL‐R3 (DcR1, CD263) (polyclonal Goat IgG) | R&D Systems | Cat#AF630; RRID:AB_355488 |
| Mouse α‐human CD314 (NKG2D) (clone 1D11) | BioLegend | Cat#320814; RRID:AB_2561488 |
| Mouse α‐human CD314 (NKG2D) PE (clone 1D11) | BioLegend | Cat#320806; RRID:AB_492960 |
| Mouse α‐human CD335 (NKp46) (clone 9E2) | Miltenyi Biotec | Cat#130‐094‐271; RRID:AB_10828456 |
| Mouse α‐human CD335 (NKp46) FITC (clone 9E2) | BioLegend | Cat#331922; RRID:AB_2561965 |
| Mouse α‐human HIV‐1 core antigen FITC (clone KC57) | Beckman Coulter | Cat#6604665 |
| Mouse α‐human p38 MAPK PE (clone 36/p38) | BD Biosciences | Cat#612565; RRID:AB_399856 |
| Mouse α‐human PLC‐γ2 PE (clone K86‐689.37) | BD Biosciences | Cat#558490; RRID:AB_647226 |
| Mouse α‐human Syk PE (clone I120‐722) | BD Biosciences | Cat#558529, RRID:AB_647247 |
| Mouse α‐human Akt PE (clone M89‐61) | BD Biosciences | Cat#560378; RRID:AB_1645328 |
| Mouse IgG1 Isotype Control (clone 15H6) | AdipoGen | Cat#AG‐35B‐0003PF |
| Mouse IgG1, κ Isotype Ctrl (clone MOPC‐21) | BioLegend | Cat#400153 |
| α‐goat IgG PE (polyclonal donkey IgG) | R&D Systems | Cat#F0107; RRID:AB_573123 |
| Human Gamma Globulin | ThermoFisher Scientific | Cat#31879; RRID:AB_2532171 |
| Oligonucleotides and other sequence‐based reagents | ||
| gRNA 5’ATAGTCCTGTCCATATTTGC3‘ | GenScript | Cat# SC1678 |
| gRNA 5’GCGGGGAGGATTGAACCACG3‘ | GenScript | Cat# SC1678 |
| Chemicals, Enzymes and other reagents | ||
| BD CellFIX (10x concentrate) | BD Biosciences | Cat#340181; RRID: AB_2868724 |
| BD Phosflow Fix Buffer I | BD Biosciences | Cat#557870; RRID: AB_2869102 |
| BD Phosflow Perm Buffer III | BD Biosciences | Cat#558050; RRID: AB_2869118 |
| Benzonase Nuclease, Purity >90% | Merck‐Millipore | Cat#71205‐3 |
| Benzonase Nuclease, Purity > 99% | Merck‐Millipore | Cat#70664‐3 |
| Blasticidin | InvivoGen | Cat#ant‐bl‐1 |
| CellTracker Violet BMQC Dye | Invitrogen | Cat#C10094 |
| CellTracker Orange CMTMR Dye | Invitrogen | Cat#C2927 |
| CellTrace Far Red | Invitrogen | Cat#C34564 |
| Immunocult Human CD3/CD28 T Cell Activator | Stemcell | Cat#10971; RRID:AB_2827806 |
| Lenti‐X Concentrator | Clontech Laboratories Inc. | Cat#631232 |
| Lipofectamine 3000 | Invitrogen | Cat#L3000‐150 |
| LIVE/DEAD Fixable Blue Dead Cell Stain Kit | Invitrogen | Cat#L34962 |
| LIVE/DEAD Fixable Near‐IR Dead Cell Stain Kit | Invitrogen | Cat#L34976 |
| Precision Count Beads | BioLegend | Cat#424902 |
| Puromycin dihydrochloride | Sigma‐Aldrich | Cat#P7255 |
| Recombinant human DcR1 protein | Abcam | Cat#ab276266 |
| Recombinant human DR4 protein | Abcam | Cat#ab641 |
| Recombinant human DR5 protein | Abcam | Cat#ab243777 |
| Recombinant human IL‐2 | PeproTech GmbH | Cat#200‐02 |
| Recombinant human IL‐15 | PeproTech GmbH | Cat#200‐15 |
| Recombinant human Osteoprotegerin protein | Abcam | Cat#ab182688 |
| Streptavidin BV421 | BioLegend | Cat#405226 |
| Streptavidin PE | BioLegend | Cat#405204 |
| Software | ||
| Flowjo v10 | BD Life Sciences | RRID:SCR_008520; https://www.flowjo.com/ |
| GraphPad Prism 9 | GraphPad Software | RRID:SCR_002798; https://www.graphpad.com/ |
| Other | ||
| BD Cytofix/Cytoperm Fixation/Permeabilization Kit | BD Biosciences | Cat#554714; RRID:AB_2869008 |
| DNeasy Blood and Tissue Kit | QIAGEN | Cat#69506 |
| EasySep Human CD4 Positive Selection Kit II | Stemcell | Cat#17852 |
| EasySep Human CD4+ T Cell Enrichment Kit | Stemcell | Cat#19052 |
| EasySep Human NK Cell Enrichment Kit | Stemcell | Cat#19055 |
| Granzyme B Human ELISA Kit | ThermoFisher Scientific | Cat#BMS2027 |
| IFN gamma Human ELISA Kit | ThermoFisher Scientific | Cat#EHIFNG |
| MACS Marker Screen, human | Miltenyi Biotec | Cat#130‐110‐055 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.