TABLE 1.
Strains, plasmids, and primers used in this studya
| Strain, plasmid, or primer | Description | Reference or source |
|---|---|---|
| P. aeruginosa | ||
| PAO1 (ATCC 15692) | Prototroph | 18 |
| PA103 | Prototroph | 24 |
| PAK | Prototroph | 30 |
| PG201 | Prototroph | 15 |
| PA1277 | Prototroph | 51 |
| Ps388 | Prototroph, hypotoxigenic | 51 |
| WR5 | Prototroph, exotoxin A deficient | 51 |
| 6B omlA::Tc | omlA mutant producing small amounts of OmlA | This study |
| 3A omlA::Tc | omlA 3′-truncated mutant | This study |
| CS fur | Cold-sensitive fur mutant of PAO1 | 20 |
| CSR fur | Spontaneous revertants of CS | This study |
| P. fluorescens | ||
| ATCC 15453 | Prototroph | ATCC |
| SBW25 | Prototroph | 37 |
| E. coli | ||
| DH5α | hsdR recA lacZYA φ80 lacZΔM15 | BRL |
| HB101 | hsdS recA proA lacY | 5 |
| QC1732 | fur null mutant | M. McIntosh |
| BL21(DE3)/pLysE | High-stringency T7 expression host, hsdS DE3, Cmr | Novagen |
| Plasmids | ||
| pBluescript SK(+) | AmprlacZ′, cloning vector | Stratagene |
| pCRII 2.1 | Ampr Kmr, PCR cloning vector | Invitrogen |
| pGEX-2T | Ampr, lacIq, Ptac-gst expression vector for protein fusions | Pharmacia |
| pSUP203 | Ampr Tcr Cmr mob, suicide vector | 46 |
| pVLT35 | Smr mob, lacIq, broad-host-range Ptrp-lac expression vector | 7 |
| pRK2013 | Kmr conjugation helper plasmid | 11 |
| pUCP19 | Ampr PlacZ, broad-host-range cloning and expression vector | 43 |
| pUCP24 | Gmr PlacZ, broad-host-range cloning and expression vector | 43 |
| pPZ20, pPZ30 | Ampr, ′lacZ-based promoter probe vector | 44 |
| pGEX-omlA | pGEX-2T containing a gst-omlA fusion under tac promoter control | This work |
| pET-omlA | pET23a containing omlA under T7 promoter control | This work |
| pOML15 | pUCP19 containing omlA as a 0.8-kb PstI-BglII fragment under lac promoter control | This work |
| pOML24 | pUCP24 containing omlA as a 0.8-kb PstI-BglII fragment | This work |
| pOML36 | pUCP19 containing a 3.6-kb PstI fragment of the omlA region | This work |
| pCRII-omlA-444a and pCRII-omlA-444b | pCRII containing the 444-bp omlA-fur promoters in omlA sense (a) or fur sense (b) orientation relative to the T7 promoter | This work |
| pPZ-PomlA | Series of pPZ20 containing various omlA promoter fragments | This work |
| pPZ-Pfur | Series of pPZ30 containing various fur promoter fragments | This work |
| pPZ-PF-PomlA | pPZ20 containing a 399-bp fragment of the P. fluorescens omlA promoter fused to lacZ | This work |
| pSUP-omlA 6B | pPSUP203 containing a 370-bp 5′ omlA fragment | This work |
| pSUP-omlA 3A | pPSUP203 containing a 291-bp internal fragment of omlA | This work |
| Primersb | ||
| omlA-(−101) | CCTCGCCTGCTTCCATC | |
| omlA-(−35) | (PstI)-CGAGCATCTGCAGGATCTTG | |
| omlA-139 | (NdeI)-catATGCAAAACGCCAAGCTCATGC | |
| omlA-156 | (HindIII)-aAGCTTGGCGTTTTGCATCG | |
| omlA-205 | (NdeI)-catATGTCGTTTCCTGGCGTCTATAAAATCG | |
| omlA-343 | GGAAGGTATCGACGATGA | |
| omlA-495 | (Stop)-tcaGAGGATCGCTTCGTCGCGGCT | |
| omlA-508 | TGCCTTCCTTGCCGAGGATC | |
| omlA-676 | (BamHI)-ggatCCAGCCGTCATTGCGGGCT |
a
Abbreviations: Ampr, ampicillin resistance; Kmr, kanamycin resistance; Tcr, tetracycline resistance; Smr, streptomycin resistance; Cmr, chloramphenicol resistance; Gmr, gentamicin resistance; ATCC, American Type Culture Collection; mob, mobilizable.
b
The primers are numbered with respect to the DNA sequence as shown in Fig. 1. Lowercase letters at the 5′ end are nonmatching nucleotides to form the indicated motif as shown underlined.