Table 2.
Sequencing primers.
| Primer name | Sequence 5′–3′ |
|---|---|
| Skp2 SCC_1351F | agaatgtctgcccttctgca |
| Skp2 SCC_1351R | ccatttcactgccacacttcc |
| Skp2 SCC_1352F | aaggaagtccagtggccatg |
| Skp2 SCC_1352R | cccgaggaatcagacagcat |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.