REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Anti-GFP | ABCAM | Cat# ab290 |
Anti GAPDH | Cell Signaling | Cat# 3675 S |
Anti-6xHis | Qiagen | Cat# 34650 |
Anti-GST | Cell Signaling | Car# 2622S |
Anti-GM-130 | Cell Signaling | Cat# 12480S |
Anti-P-FAK-Y397 | ThermoFisher | Cat# 44-624G |
Anti-FAK Antibody, clone 4.47 | Millipore | Cat# 05-537 |
Anti- MARK2 C-terminal | ABCAM | Cat# ab136872 |
Anti-MARK1 | Cell Signaling | Cat# 3319S |
Anti-MARK3 | ABCAM | Cat# Ab 52626 |
Anti p-MLC S19 | Cell Signaling | Cat# 3675S |
Anti-Myc tag | Cell Signaling | Cat# 2276 |
Anti-MYPT1 | Millipore | Cat# 07-672-1 |
Anti P-MYPT T696 | Millipore | Cat# AB545 |
Anti-P-MYPT T853 | Cell Signaling | Cat# 4563S |
Anti-Myosin IIA (MYH9) | Sigma | Cat# M8064 |
Anti-alpha tubulin clone DM1A | Sigma | Cat# 05-829 |
HRP-conjugated goat anti-mouse | Jackson ImmunoResearch | Cat# 115-035-174 |
HRP-conjugated Donkey anti-mouse | Jackson ImmunoResearch | Cat# 112-035-175 |
Bacterial and virus strains | ||
MAX Efficiency™ DH5α Competent Cells | ThermoFisher | Cat# 18258012 |
Chemicals, peptides, and recombinant proteins | ||
MARK2, Active | SignalChem | Cat# M44-10G |
MARK3, Active | SignalChem | Cat# M45-10G |
ROCK2, Active | SignalChem | Cat# R11-RH-10 |
MLCK, Active | 89 | N/A |
His-MRLC | 90 | N/A |
Calmodulin | .89 | N/A |
CHKtide | SignalChem | Cat# C10-58 |
MRLC peptide | SignalChem | Cat# C09-58 |
MYPT1, (fragment 654-880) | Millipore Sigma | Cat# 12-457 |
PhosSTOP | Roche | Cat#04906845001 |
PrecipHen | Aves Lab | Cat# P-1010 |
Native myosin (chicken gizzard) | 91 | N/A |
Purified MRLC (chicken gizzard) | 91 | N/A |
S-protein agarose | Merck Millipore | Cat# 69704 |
PhosSTOP Phosphatase inhibitors (Roche) | Millipore/sigma | Cat# 4906845001 |
cOmplete™, Mini, EDTA-free Protease Inhibitor Cocktail (Roche) | Millipore/Sigma | Cat# 11836170001 |
Tween-20 | Sigma | Cat# P1379 |
Fetal Bovine Serum | Atlanta Biologicals-Biotechme | Cat# S11150 |
McCoy’s 5A | ThermoFisher | Cat# 36600021 |
EC-Oxyrase | OXYRASE | Cat# EC-0005 |
Radiance ECL | Azure Biosystems |
Cat# AC2204 |
Alexa Fluor 647 NHS esther | ThermoFisher | Cat# A20006 |
Human Plasma Fibronectin | Millipore | Cat# FC010 |
Alexa Fluor 488 Phalloidin | ThermoFisher | Cat# A12379 |
Alexa 568 Phalloidin | ThermoFisher | Cat# A12380 |
Critical commercial assays | ||
EndoFree Plasmid Maxi Kit | Qiagen | Cat# 12362 |
Primo system (micropattering) | Alveole (Paris) | N/A |
SE Cell Line 4D-Nucleofector X Kit V | Lonza | Cat #: VACA-1003 |
GFP-Trap magnetic Agarose | Chromotek | Cat# gtma-20 |
XtremeGene9 | Roche | Cat# 6365779001 |
QuikChange II XL | Agilent Technologies | Cat# 200521 |
Experimental models: Cell lines | ||
U2OS | ATCC | Cat# HTB-96 |
U2OS MARK2-KO | This study | N/A |
U2OS MARK2-KO-MARK2-EGFP | This study | N/A |
U2OS MARK2-KO-MARK2-DKA-EGFP | This study | N/A |
U2OS MARK2-KO-MARK2-mApple | This study | N/A |
Cos1 | ATCC | Cat# CRL-1650 |
Oligonucleotides | ||
On Target plus Human MARK3 SiRNA | Dharmacon (Horizon) | Cat# L-00357-00-0020 |
On Target plus Human MARK2 SiRNA | Dharmacon (Horizon) | Cat# L-004260-00-0020 |
MARK2-KO Guide 1 (GGAGCCGGTAGTTTCCAATG ) |
This paper | N/A |
MARK2-KO Guide2 (GTGTCGGGCCAACTTCACCT) | This paper | N/A |
MARK2-KO Guide 3(AGCCCCACATTGGAAACTAC) | This paper | N/A |
Recombinant DNA | ||
MARK2-EGFP | 38 | N/A |
MARK2-mApple | 38 | N/A |
MARK2-DKA-EGFP | This paper | N/A |
pGFP-MYPT1 | 92 | N/A |
pTriEX4-MARK2 | This project | N/A |
pTriEX4 | MERK Sigma | 70824 |
Myosin IIA-GFP | Michael Davidson Lab Florida State University | N/A |
EGFP-C1 | Michael Davidson Lab Florida State University | N/A |
m-Apple-C1 | Michael Davidson Lab Florida State University | N/A |
Paxillin-GFP | Michael Davidson Lab Florida State University | N/A |
pSpCas9n(BB)-2A-Puro (PX462) V2.0 | Addgene | Cat# 62987 |
Software and algorithms | ||
Metamorph 7.8.0.0 ID:32415 | 1992-2013 | https://www.moleculardevices.com/products/cellular-imaging-systems/acquisition-and-analysis-software/me |
GraphPad Prism 9.0.2 | 2021 | https://www.graphpad.com/scientific-software/prism/ |
Other | ||
Novex Wedgewell 4–12 % tris-Glycine gel Invitrogen | ThermoFisher | Cat# XP04120BOX |
Novex Wedgewell 4–20 % tris-Glycine gel Invitrogen | ThermoFisher | Cat# XP04202BOX |