TABLE 1.
Strains, plasmids, and PCR primers used in this study
| Strain, plasmid, or primer | Relevant genotype or sequence | Reference or source |
|---|---|---|
| C. crescentus strains | ||
| NA1000 | Synchronizable derivative of C. crescentus CB15 | 8 |
| LS2515 | NA1000 with a chromosomal integration of ctrAΔ3M2 as the only copy of ctrA in the cell | 4 |
| LS2531 | NA1000 with a chromosomal integration of the PfliQ::neo reporter | 18a |
| Plasmids | ||
| pAR154 | pCR2.1 + PccrM (−44CGTGGT-to-AACCCC mutant) | This study |
| pAR155 | pCR2.1 + PccrM (−44CGTGG-to-AACCCC mutant) | This study |
| pAR156 | pRKlac290 + PccrM (−44CGTGGT-to-AACCCC mutant) | This study |
| pAR157 | pRKlac290 + PccrM (−44CGTGG-to-AACCCC mutant) | This study |
| pBluescriptII | Ampr cloning vector | Stratagene |
| pCR2.1 | Ampr Kanr vector used for cloning PCR products | Invitrogen |
| pCS148 | pRKlac290 + PccrM (−45 to +19) | 27 |
| pCS155 | pRKlac290 + PccrM (−36AC-to-TG mutant) | 27 |
| pCS156 | pRKlac290 + PccrM (−28CTAA-to-AATT mutant) | 27 |
| pCS179 | pBluescriptII + entire ccrM locus and promoter region | 27 |
| pKJH5 | C terminus of EnvZ in pMAL-c2 (New England Biolabs) | 11 |
| pRKlac290 | lacZ transcriptional fusion vector; pRK290 derivative | 10 |
| pTRC7.4 | pTrcHisA + ctrA coding sequence | 19 |
| pTrcHisA | Vector for expressing His6-containing proteins | Invitrogen |
| pWZ20 | pBluescriptII + entire fliQ locus and promoter | 32 |
| pWZ162 | pRKlac290 + PfliQ (−268 to +378) | 32 |
| pXD51E | ctrAD51E coding sequence inserted in pTRC7.4 | This study |
| PCR primersa | ||
| ccrM725 | (−178)GTCCCTCGCCGATCCATC(−160) | |
| ccrM1047R | (+144)GGGCGGATCCGCGAAGATCAGG(+122) | |
| ccrM1129R | (+226)CGAACGGATCCCAGTGGTCG(+206) | |
| ccrMecoRI | (−104)CTAGACCTTTGAATTCCTTCAACTTTG(−77) | |
| ccrM IR2mut | (−57)GCGCCTGAAAGGCAACCCCTAACGGCCC(−30) | |
| ccrMpstpe | (+159)CAGCTGCAGATTATAGGG(+141) | |
| fliQ399 | (−181)AGGTCCAGGTCGATCTGCT(−162) | |
| fliQ468 | (−112)GTATCCGCATCCGCTAATCA(−92) | |
| fliQ815R | (+235)AGATGAATTCCGCCACGATCT(+214) |
a
Sequences are oriented 5′ to 3′. Underlined bases are sites at which mutations were introduced to generate restriction sites or promoter mutants.