TABLE 1.
Bacterial strains and 16S rDNA sequences used in this study
| Species and/or straina | Origina | Phenotypeb | Signature (180–192)c | Source or reference(s)d |
|---|---|---|---|---|
| E. coli | Mesophilic | AACGT-------CGCAAGA--C | 2, 3, 8 | |
| B. subtilis | Mesophilic | GTTGTTT-GAACCGCATGGTTC | 14 | |
| B. cereus | ||||
| WSBC10027 | Weihenstephan, Germany; pasteurized milk | Mesophilic | AACATTTTGAACCGCATGGTTC | 21 |
| WSBC10028 | Weihenstephan, Germany; pasteurized milk | Mesophilic | ********************** | 21 |
| WSBC10030 | Weihenstephan, Germany; pasteurized milk | Mesophilic | ********************** | 21 |
| WSBC10032 | Weihenstephan, Germany; pasteurized milk | Mesophilic | ********************** | 21 |
| WSBC10033 | Weihenstephan, Germany; pasteurized milk | Mesophilic | ********************** | 21 |
| WSBC10034 | Weihenstephan, Germany; pasteurized milk | Mesophilic | ********************** | 21 |
| WSBC10035 | Weihenstephan, Germany; pasteurized milk | Mesophilic | ********************** | 21 |
| WSBC10037 | Weihenstephan, Germany; pasteurized milk | Mesophilic | ********************** | 21 |
| ATCC27877 | ATCC | Mesophilic | ********************** | 21 |
| IAM12605 | N.D. | ********************** | 32 | |
| NCTC11143 | N.D. | ********************** | 1 | |
| WSBC10312 | Thailand; kurkuma root | Mesophilic | N.D. | 36 |
| B. weihenstephanensis | ||||
| WSBC10201 | Weihenstephan, Germany; pasteurized milk | Psychrotolerant | **T*********T****A**** | 21 |
| WSBC10204T | Weihenstephan, Germany; pasteurized milk | Psychrotolerant | **T*********T****A**** | 21 |
| WSBC10205 | Weihenstephan, Germany; pasteurized milk | Psychrotolerant | **T*********T****A**** | 21 |
| WSBC10206 | Weihenstephan, Germany; pasteurized milk | Psychrotolerant | **T*********T****A**** | 21 |
| WSBC10207 | Weihenstephan, Germany; pasteurized milk | Psychrotolerant | **T*********T****A**** | 21 |
| WSBC10210 | Weihenstephan, Germany; pasteurized milk | Psychrotolerant | **T*********T****A**** | 21 |
| WSBC10311 | Weihenstephan, Germany; soil | Psychrotolerant | N.D. | 36 |
| B. mycoides | ||||
| WSBC10276 | Weihenstephan, Germany; pasteurized milk | Psychrotolerant | **T*********T****A**** | 21 |
| WSBC10279 | Weihenstephan, Germany; pasteurized milk | Psychrotolerant | **T*********T****A**** | 21 |
| WS2641T | DSM2048 | Psychrotolerant | **T*********T****A**** | 21 |
| B. thuringiensis | ||||
| WS2614 | HER1211 | Mesophilic | AACATTTTGAACCGCATGGTTC | 21 |
| WS2617 | HER1232 | Mesophilic | ********************** | 21 |
| WS2618 | HER1233 | Mesophilic | ********************** | 21 |
| WS2625 | HER1387 | Mesophilic | ************T********* | 21 |
| WS2626 | HER1404 | Mesophilic | ********************** | 21 |
| WS2627 | HER1410 | Mesophilic | N.D. | Ackermann |
| WS2629 | HER1418 | Mesophilic | N.D. | Ackermann |
| IAM12077 | N.D. | ************T********* | 32 | |
| NCIMB9134 | N.D. | ************T********* | 1 | |
| B. anthracis “Sterne” | Mesophilic | ********************** | 1 | |
| Other strains | ||||
| WSBC10246 (S38/21) | Copenhagen, Denmark; soil | Mesophilic | N.D. | 6 |
| WSBC10250 (S38/25) | Copenhagen, Denmark; soil | Mesophilic | N.D. | 6 |
| WSBC10313 (3) | Kiel, Germany; milk powder | Mesophilic | N.D. | 38 |
| WSBC10314 (4) | Kiel, Germany; milk powder | Mesophilic | N.D. | 38 |
| WSBC10315 (6) | Kiel, Germany; milk powder | Psychrotolerant | N.D. | 38 |
| WSBC10316 (46) | Kiel, Germany; milk powder | Mesophilic | N.D. | 38 |
| WSBC10310 | Weihenstephan, Germany; soil | Mesophilic | N.D. | 36 |
| WSBC10297 | Weihenstephan, Germany; soil | Psychrotolerant | N.D. | 36 |
DSM, Deutsche Sammlung für Mikroorganismen und Zellkulturen, Braunschweig, Germany; ATCC, American Type Culture Collection, Rockville, Md.; HER, Centre de référence pour virus bactériens, Felix d’Herbelle Université Laval, H.-W. Ackermann, Quebec, Canada; WS, Weihenstephan Collection, Institute of Microbiology, FML Weihenstephan, Freising, Germany; WSBC, Weihenstephan Bacillus cereus Collection, Institute of Microbiology, FML Weihenstephan, Freising, Germany.
Psychrotolerant strains are able to grow at and below 7°C (27). N.D., not determined.
According to the E. coli nomenclature (2, 3, 8). According to the B. cereus nomenclature (1), the signature is located at bp 180 to 201. Letters in boldface are the signature bases. N.D., not determined.
References are given for the accession numbers of 16S rDNA sequences if sequences are available. In all other cases, the reference for the strain is given.