Table 1.
sgRNA sequences used in the HSPC experiments
| sgRNA name | sgRNA sequence |
|---|---|
| TERT exon 4 | acaaucggccgcagcccguc |
| TERT exon 9 | gcuguuugcggggauucggc |
| TIN2 exon 6 | agggaaacagcaugacugug |
| TIN2 exon 2 | ucaggacuugggcccaaggc |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.