REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
phosphorylated RET-Y905 | Cell Signaling Technology | Cat#3221; RRID: AB_2179887 |
phosphorylated RET-Y1062 | Abcam | Cat#ab51103; RRID: AB_870738 |
RET E1N8X | Cell Signaling Technology | Cat#14556; RRID: AB_2798509 |
RET | Abcam | Ab134100; RRID: AB_2920824 |
phosphorylated AKT-S473 | Cell Signaling Technology | Cat#9271; RRID: AB_329825 |
AKT | Cell Signaling Technology | Cat#9272; RRID: AB_329827 |
phosphorylated ERK T202/Y204 | Cell Signaling Technology | Cat#4377; RRID: AB_331775 |
ERK1/ERK2 | Cell Signaling Technology | Cat#4695; RRID: AB_390779 |
GRB2 | Cell Signaling Technology | Cat#36344; RRID: AB_2920901 |
PARP | Cell Signaling Technology | Cat#9542; RRID: AB_2160739 |
β-actin | Cell Signaling Technology | Cat#3700; RRID: AB_2242334 |
α-tubulin | Cell Signaling Technology | Cat#3873; RRID: AB_1904178 |
Purified anti-HA.11 Epitope Tag Antibody | BioLegend | Cat#901501; RRID: AB_2565006 |
Anti-Myc/c-Myc Antibody (9E10) | Santa Cruz Biotechnology | Cat#sc-40; RRID: AB_2857941 |
Na,K-ATPase α1 (D4Y7E) Rabbit mAb | Cell Signaling Technology | Cat#23565; RRID: AB_2798866 |
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | Cat#A-11001; RRID: AB_2534069 |
Alexa Fluor™ 647 Goat Anti-Rabbit SFX Kit, highly cross-adsorbed | Invitrogen | Cat#A31634 |
Anti-Ret Antibody (8D10C9) | Santa Cruz Biotechnology | Cat#sc-101422; RRID: AB_2269605 |
Bacterial and virus strains | ||
ONE SHOT STBL3 COMP E COLI | Invitrogen | Cat#C737303 |
Biological samples | ||
Human tumor samples | This paper | N/A |
Chemicals, peptides, and recombinant proteins | ||
RPMI (cell medium) | Corning | Cat#10040-CV |
Fetal Bovine Serum | Gibco | Cat#26140079 |
DAPI (4′,6-Diamidino-2-Phenylindole, Dilactate) | Thermo Fisher Scientific | Cat#EN62248 |
TrypLE Select, 10× | Thermo Fisher Scientific | Cat#A1217701 |
Hygromycin B | Invitrogen | Cat# 10687010 |
Puromycin dihydrochloride | Gibco | Cat#A1113803 |
Blasticidin | Gibco | Cat#R21001 |
Selpercatinib | ChemieTek | Cat#CT-LX292 |
Pralsetinib | ChemieTek | Cat#CT-BLU667 |
Human GDNF (glial-derived neurotrophic factor) | Preprotech | Cat#450-10-100UG |
Recombinant Murine IL-3 | Preprotech | Cat#213-13 |
Critical commercial assays | ||
NEBNext® Ultra TM RNA Library Prep Kit for Illumina | New England BioLabs | Cat#E7760L |
High-Capacity cDNA Reverse Transcription Kit | Applied Biosystems | Cat#4368814 |
Phusion High-Fidelity PCR Master Mix with GC Buffer | Thermo Fisher Scientific | Cat#F532L |
iQ SYBR Green Supermix | Bio-Rad | Cat#1708880 |
Deposited data | ||
RET::GRB2 ORF sequence | This paper | NCBI-Bankit (accession number: ON799207) |
Experimental models: Cell lines | ||
293FT Cell Line | Thermofisher/Invitrogen | Cat#R70007 |
SH-SY5Y | ATCC | Cat#CRL-2266 |
Ba/F3 | Creative Biogene | Cat#CSC-RO0120 |
Oligonucleotides | ||
Primer: RET-GRB2 long isoform_F Forward: TTGCGGACATCAGCAAAG | This paper | N/A |
Primer: RET-GRB2 long isoform_F Reverse: CAGGAGCGCTCTCACTCTCT | This paper | N/A |
Primer: RET-GRB2 short isoform_F Forward: TGCGGACATCAGCAAAGAC | This paper | N/A |
Primer: RET-GRB2 short isoform_R Reverse: GAACTTCACCACCCAGAGG A | This paper | N/A |
Primer RETe4F TGGTGATGGTGCCCTTCC | This paper | N/A |
Primer RETe5R CTGATGCAGGTACCACGTCT | This paper | N/A |
Primer: RET_e8_cDNA_F Forward: GGCTGGAGTGTGAGGAGTGT | This paper | N/A |
Primer: RET_e9_cDNA_R Reverse: AGGTCTTGGTGCTGGGAGA G | This paper | N/A |
Primer: RET_e19_cDNA_F Forward: CTGGTGGACTGTAATAATGC | This paper | N/A |
Primer: RET_e20_cDNA_R Reverse: TTGGATATCTTGGAAACCCA | This paper | N/A |
Recombinant DNA | ||
pLV[Exp]-Puro-EF1A>3x N-flag-RET_1-18_GRB2_2-3-4-5 | This paper | Custom order-By VectorBuilder VB210223-1137nqa |
pLV[Exp]-Hygro- EF1A>hRET[NM_020975.6]/Myc | This paper | Custom order-By VectorBuilder VB210227-1059nqh |
pLV[Exp]-Bsd- EF1A>hRET[NM_020630.6]/Myc | This paper | Custom order-By VectorBuilder VB210227-1062nya |
pLV[Exp]-Puro-EF1A>[C-HA- RET_1-18-GRB2_2-3-4-5]/HA | This paper | Custom order-By VectorBuilder VB210227-1065xvg |
pLV[Exp]-EGFP:T2A:Puro- EF1A>mCherry | VectorBuilder Inc | By VectorBuilder VB160109-10005 |
pLV[Exp]-Puro- EF1A>[C-HA-RET_1-18-GRB2_2-3-4-5]/HA | This paper | Custom order-By VectorBuilder VB210227-1065xvg |
psPAX2 | Addgene | Addgene #12260; RRID:Addgene_12260 |
pMD2.G | Addgene | Addgene #12259; RRID:Addgene_12259 |
pLV-RET51-c-Myc-C634R | This paper | N/A |
pLV-RET51-c-Myc-K758M | This paper | N/A |
pLV-RET9-c-Myc-D1014X | This paper | N/A |
pLV-RETGRB2-K758M-HA | This paper | N/A |
Software and algorithms | ||
Spliced Transcripts Alignment to a Reference (STAR) | Dobin et al., 201326 | http://code.google.com/p/rna-star/ |
HTSeq v.0.6.1 | Putri et al., 202127 | http://www-huber.embl.de/HTSeq |
Gene Set Enrichment Analysis (GSEA) | Subramanian et al., 200528 | https://www.gsea-msigdb.org/gsea/index.jsp |
ImageJ | Abramoff et al., 201229 | https://imagej.nih.gov/ij/ |
MiSeq | Illumina | https://www.illumina.com/systems/sequencing-platforms/miseq.html |