Table 1.
Details of SNP evaluated in the study with early primary knee osteoarthritis and controls
S. No | SNPedia | Orientation Details |
1 | Gene | MTHFR |
2 | Reference sequence number | rs1801133 |
3 | Condition | Early primary knee Osteoarthritis |
4 | Organism | Homo sapiens |
5 | Mutation | Non-synonymous single nucleotide polymorphism |
6 | Amnio acid substitution | C677T (Ala 677 Val) |
7 | Single Nucleotide Polymorphism | C-T |
8 | Exon position | Exon 5 |
9 | Chromosome Region | Chromosome-1 p36.22 |
10 | 5′-3′ Primer sequence | TGAAGGAGAAGGTGTCTGCGGGA |
11 | 3′-5′ Primer Sequence | GGACGGTGCGGTGAGAGTG |
12 | PCR Amplicon size | 198bp |
13 | Restriction Enzyme | Hinf1 |
14 | Substitution of Nucleotide band size | 176bp |
15 | Digested amplicon size | CC: 198bp ; CT:198/176/282bp ; TT176/22bp |
16 | Genotype effect | CC: Normal or no risk CT: Increased risk TT: Increased risk |