| Antibodies |
| MSRA |
Invitrogen |
Cat# PA5-88562, RRID:AB_2804997 |
| MSRA |
Sigma Prestige |
Cat#HPA053069, RRID:AB_2682032 |
| MSRB1 |
ThermoFisher |
Cat#LF-PA0088, RRID:AB_2285669 |
| MSRB1 |
Sigma Prestige |
Cat#HPA069557, RRID:AB_2686153 |
| MSRB2 |
ThermoFisher |
Cat#PA5-99072, RRID:AB_2813685 |
| PKM1/2 |
Cell Signaling Technology |
Cat#3190, RRID:AB_2163695 |
| PKM1 |
Cell Signaling Technology |
Cat#7067, RRID:AB_2715534 |
| PKM2 |
Cell Signaling Technology |
Cat#4053, RRID:AB_1904096 |
| Vinculin |
Cell Signaling Technology |
Cat#4650, RRID:AB_10559207 |
| Vinculin |
Sigma-Aldrich |
Cat#V9131, RRID:AB_477629 |
| Tubulin |
Cell Signaling Technology |
Cat#2148, RRID:AB_2288042 |
| Actin |
Cell Signaling Technology |
Cat#8456, RRID:AB_10998774 |
| V5 tag |
EMD Millipore |
Cat#AB3792, RRID:AB_91591 |
| Flag M2 tag |
Sigma-Aldrich |
Cat#F1804, RRID:AB_262044 |
| Myc tag |
Cell Signaling Technology |
Cat#2276, RRID:AB_331783 |
| GAPDH |
Cell Signaling Technology |
Cat#2118, RRID:AB_561053 |
| PGK1 |
Invitrogen |
Cat#PA5-28612, RRID:AB_2546088 |
| Phospho-p44/42 MAPK (T202/Y204) |
Cell Signaling Technology |
Cat#9101, RRID:AB_331646 |
| P44/42 MAPK |
Cell Signaling Technology |
Cat#4695, RRID:AB_390779 |
| Phospho-STAT3 (Y705) |
Cell Signaling Technology |
Cat#9145, RRID:AB_2491009 |
| STAT3 |
Cell Signaling Technology |
Cat#9139, RRID:AB_331757 |
| Phospho-SMAD3 (S423/425) |
Cell Signaling Technology |
Cat#9520, RRID:AB_2193207 |
| SMAD3 |
Cell Signaling Technology |
Cat#9513, RRID:AB_2286450 |
| Phospho-AKT (S473) |
Cell Signaling Technology |
Cat#4060, RRID:AB_2315049 |
| AKT |
Cell Signaling Technology |
Cat#4685, RRID:AB_2225340 |
| Phospho-FAK (Y397) |
Cell Signaling Technology |
Cat#8556, RRID:AB_10891442 |
| Phospho-FAK (Y576/577) |
Cell Signaling Technology |
Cat#3281, RRID:AB_331079 |
| Phospho-FAK (Y925) |
Cell Signaling Technology |
Cat#3284, RRID:AB_10831810 |
| FAK |
Cell Signaling Technology |
Cat#13009, RRID:AB_2798086 |
| Phospho-AMPKa (T172) |
Cell Signaling Technology |
Cat#4188, RRID:AB_2169396 |
| AMPKa |
Cell Signaling Technology |
Cat#5831, RRID:AB_10622186 |
| Phosph-p70 S6 kinase (T389) |
Cell Signaling Technology |
Cat#9234, RRID:AB_2269803 |
| p70 S6 kinase |
Cell Signaling Technology |
Cat#2708, RRID:AB_390722 |
| Streptavidin-HRP conjugate |
Jackson ImmunoResearch |
Cat#016-030-084, RRID:AB_2337238 |
| Anti-cysteine sulfenic acid |
Millipore |
Cat#07-2139-I-25UL, RRID:AB_1977145 |
| PKM2 mAb sepharose bead conjugate |
Cell Signaling Technology |
Cat#13266, RRID:AB_2798165 |
| Anti 4-hydroxynonenal (HNE) |
Alpha Diagnostic International |
Cat#HNE11-S, RRID:AB_2629282 |
| ATP5A |
Abcam |
Cat#ab14748, RRID:AB_301447 |
| Histone H3 |
Cell Signaling Technology |
Cat#4499, RRID:AB_10544537 |
| Biological samples |
|
|
| Human pancreatic tumor and metastatic specimens |
University of Nebraska Medical Center’s Rapid Autopsy Program for Pancreas |
N/A |
| Deidentified human pancreatic tumor and adjacent normal specimens |
Herbert Irving Comprehensive Cancer Center (HICCC) Tissue Bank |
N/A |
| Chemicals, peptides, and recombinant proteins |
| TMT10plex Isobaric label reagent |
ThermoFisher Scientific |
Cat#90110 |
| Trypsin/Lysine-C protease mix |
ThermoFisher Scientific |
Cat#A41007
|
| 1M TEAB |
ThermoFisher Scientific |
Cat#90114 |
| Adenosine 5’-diphosphate sodium salt |
Sigma-Aldrich |
Cat#A2754 |
| Phospho(enol)pyruvic acid monopotassium salt |
Sigma-Aldrich |
Cat#P7127 |
| anti-Flag M2 magnetic beads |
Sigma-Aldrich |
Cat#M8823 |
| 3 × Flag peptide |
Sigma-Aldrich |
Cat#F4799 |
| Native lysis buffer |
Abcam |
Cat#ab156035 |
| DYn-2 |
Cayman Chemical |
Cat#11220 |
| Iodoacetamide-alkyne |
Oakwood Chemical |
Cat#95226 |
| Dimedone |
Sigma-Aldrich |
Cat#D153303 |
| 50% glutaraldehyde |
Alfa Aesar |
Cat#A10500 |
| L-Aspartate |
Genaxxon Bioscience |
Cat#M6092.0250 |
| Oligomycin-A |
Sigma-Aldrich |
Cat#75351 |
| ML-265 (TEPP46) |
Selleckchem |
Cat#S7302 |
| ML-265 (TEPP46) |
Cayman Chemical |
Cat#13942 |
| AZD7545 |
Cayman Chemical |
Cat#19282 |
| Rotenone |
Millipore |
Cat#557368 |
| FCCP |
Sigma-Aldrich |
Cat#C2920 |
| 2DG |
Alfa Aesar |
Cat#AAL0733806 |
| Paraformaldehyde |
Electron Microscopy Sciences |
Cat#15710 |
| N-ethylmaleimide (NEM) |
Sigma-Aldrich |
Cat#E3876 |
| Dichloromethane |
Fisher Scientific |
Cat#D151-1 |
| LC/MS grade methanol |
Sigma-Aldrich |
Cat#900688 |
| LC/MS grade H2O |
Sigma-Aldrich |
Cat#900682 |
| Phalloidin FITC conjugate (reconstituted in methanol to 200U/ml) |
Biotium |
Cat#00030 |
| D-luciferin |
Goldbio |
Cat#LUCK |
| Carboxymethylcellulose |
Sigma-Aldrich |
Cat#C5678 |
| Tween80 |
Sigma-Aldrich |
Cat#P1754 |
| Nutlin-3a |
Sigma-Aldrich |
Cat#SML0580-5MG |
| Glucose |
Sigma-Aldrich |
Cat#G7021-100G |
|
13C6-Glucose |
Cambridge Isotope Laboratories |
Cat#CLM -1396-PK |
| Carprofen |
RIMADYL NADA |
Cat#41-199 |
| X-tremeGENE9 |
Sigma-Aldrich |
Cat#6365787001 |
| Polybrene |
Millipore |
Cat#TR1003G |
| Lipofectamine RNAiMAX transfection reagent |
Invitrogen |
Cat#13778075 |
| Lipofectamine 2000 transfection reagent |
Invitrogen |
Cat#11668027 |
| jetOPTIMUS |
Polyplus |
Cat#101000025 |
| TEPP46 |
(Jiang et al., 2010) |
Craig J. Thomas lab |
| PG1-FM |
(Iwashita et al., 2021) |
Christopher J. Chang lab |
| Methoxyamine hydrochloride |
Sigma-Aldrich |
Cat#226904 |
|
N-tert-Butyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA) |
Sigma |
Cat#M-108 |
| MitoTracker green FM |
Cell Signaling Technology |
Cat#9074 |
| Hygromycin |
Fisher Scientific |
Cat#10687010 |
| Antimycin A |
Sigma-Aldrich |
Cat#A8674-25MG |
| MitoTempo |
Cayman Chemical |
Cat#16621 |
| N-acetyl-L-cysteine |
Sigma-Aldrich |
Cat#A9165-25G |
| L-Asparagine |
Sigma-Aldrich |
Cat#A4159-25G |
| Critical commercial assays |
| Kinase-Glo plus luminescent kinase assay |
Promega |
Cat#V3771 |
| Pyruvate kinase activity assay kit |
Sigma-Aldrich |
Cat#MAK072 |
| NADP/NADPH colorimetric assay kit |
BioVision |
Cat#k347 |
| Aspartate colorimetric/fluorometric assay kit |
BioVision |
Cat#K552 |
| CellTiter-Glo |
Promega |
Cat#G7572 |
| Protein carbonyl assay kit |
Abcam |
Cat#ab178020 |
| BCA protein assay kit |
Thermo Scientific |
Cat#23227 |
| QCM ECMatrix Cell Invasion Assay |
Sigma-Aldrich |
Cat#ECM550 |
| Peptide fluorescent quantification kit |
Thermo Scientific |
Cat#23290 |
| Cell Fractionation Kit |
Abcam |
Cat#ab109719 |
| Deposited data |
| Reactive methionine profiling |
This study |
MSV000089315 |
| Glucose tracing |
This study |
MSV000089514 |
| Experimental models: Cell lines |
| Human: HEK293T |
ATCC |
Cat# CRL-3216, RRID:CVCL_0063 |
| Mouse: KPC derived PDAC organoids |
This study |
N/A |
| Mouse: KPC derived PDAC cell lines |
This study |
N/A |
| Human: Phoenix-ECO |
ATCC |
Cat#CRL-3214, RRID:CVCL_H717 |
| Experimental models: Organisms/strains |
| Mouse: C57BL/6J |
Jackson Laboratories |
Stock#000664, IMSR_JAX:000664 |
| Mouse: Kras+/LSL-G12D
|
Jackson Laboratories |
Stock#008179, IMSR_JAX:008179 |
| Mouse: p53+/LSL-R172H
|
Jackson Laboratories |
Stock#008652, IMSR_JAX:008652 |
| Mouse: Pdx1-Cre |
Jackson Laboratories |
Stock#014647, IMSR_JAX:014647 |
| Oligonucleotides |
| gRNA targeting MSRA (sgMsrA9.1): CACCGTACACAACCCGGACGACTT |
This study |
N/A |
| gRNA targeting MSRA (sgMsrA10.1): AAACCCGTGCAGATGGAAGCAGCC |
This study |
N/A |
| gRNA targteting ROSA locus (sgRosa26): GAAGATGGGCGGGAGTCTTC |
This study |
N/A |
| siRNA targeting human MsrA |
Dharmacon |
Cat#L-012464-00-0005 |
| p53 loxP Fw: 5’AGCCTGCCTAGCTTCCTCAGG |
This study |
N/A |
| p53 loxP Rv: 5’CTTGGAGACATAGCCACACTG |
This study |
N/A |
| Recombinant DNA |
| hMsrA-Myc-Flag-pCMV6-entry |
Origene |
Cat# RC208916 |
| hMsrA-Myc-pCMV6-entry |
This study |
N/A |
| hMsrA-Myc-Flag-pBABE-puro |
This study |
N/A |
| mMsrA-Myc-Flag-pCMV6-entry |
Origene |
Cat#MR202816 |
| mMsrA-Myc-Flag-pBABE-puro |
This study |
N/A |
| hPKM1-Flag-pCDNA3.1(+) |
This study |
N/A |
| mPKM1-V5-pBABE-neo |
This study |
N/A |
| hPKM2-Flag-pCDNA3.1 (+) |
This study |
N/A |
| mPKM2-Flag-pBABE-neo |
This study |
N/A |
| EFS-Cas9-P2A-Puro |
Addgene |
Addgene#108100 |
| roGFP2-Orp1 |
(Morgan et al., 2011) |
Tobias Dick lab |
| Mito-roGFP-Orp1 |
(Morgan et al., 2011) |
Tobias Dick lab |
| Grx1-roGFP2 |
(Morgan et al., 2011) |
Tobias Dick lab |
| Mito-Grx1-roGFP2 |
(Morgan et al., 2011) |
Tobias Dick lab |
| Software and algorithms |
| ImageJ |
National Institutes of Health |
https://imagej.nih.gov/ij/, RRID:SCR_003070 |
| GraphPad Prism |
GraphPad |
http://www.graphpad.com/, RRID:SCR_002798 |
| ChemBioDraw 13.0 |
PerkinElmer |
https://www.perkinelmer.com/category/chemdraw, RRID:SCR_016768 |
| Agilent MassHunter Quant software |
Agilent Technologies |
https://www.agilent.com/en/promotions/masshunter-mass-spec, RRID:SCR_015040 |
| PAW (Proteomic Analysis Workflow) pipeline |
(Wilmarth et al., 2009) |
https://github.com/pwilmart/PAW_pepeline
|
| Limma package |
(Smyth, 2004) |
https://bioconductor.org/packages/release/bioc/html/limma.html
|
| MSFragger |
(Kong et al., 2017) |
https://msfragger.nesvilab.org/
|
| QuPath |
(Bankhead et al., 2017) |
https://qupath.github.io/, RRID:SCR_018257 |
| FlowJo |
BD |
https://www.flowjo.com/ RRID:SCR_008520 |
| Vevo Lab 2.2.1 |
Fujifilm VisualSonics |
https://www.visualsonics.com/product/software/vevo-lab RRID:SCR_015816 |
| Living Image |
Perkin Elmer |
https://www.perkinelmer.com/category/image-analysis-software RRID:SCR_014247 |
| Aperio Cytoplasm algorithm |
Leica Biosystems |
https://www.leicabiosystems.com/us/digital-pathology/analyze/ihc/aperio-cytoplasm-algorithm/ RRID:SCR_021016 |
