Skip to main content
. Author manuscript; available in PMC: 2022 Aug 24.
Published in final edited form as: Cell. 2022 Apr 29;185(10):1676–1693.e23. doi: 10.1016/j.cell.2022.04.005

KEY RESOURCES TABLE.

REAGENT or RESOURCE Antibodies SOURCE IDENTIFIER

Antibodies

CD144 (VE-Cadherin) MicroBeads MiltenyiBiotec 130-097-857
anti-phospho-NF-kB p65 antibody Cell Signaling #3033; AB_2341216
anti-NF-κB p65 antibody Cell Signaling #8242; AB_10859369
anti-IKB alpha antibody Abcam ab32518; AB_733068
anti-phospho-IκBα antibody Cell Signaling #9246; RRID: AB_2267145
anti-TLR4 antibody Abcam ab89455; RRID: AB_2043061
anti-MyD88 antibody Cell Signaling #3699; RRID: AB_2282236
anti-p38 MAPK antibody Cell Signaling #8690; RRID: AB_10999090
anti-phospho-p38 MAPK antibody Cell Signaling #9211; RRID: AB_331641
anti-F4/80 antibody Abcam ab111101; RRID:AB_10859466
anti-CD68 antibody Bio-Rad MCA1957; RRID:AB_322219
anti-beta actin antibody GeneTex GTX109639; RRID:AB_1949572

Bacterial and virus strains

Escherichia coli DH5a competent cells Zymo Research T3007

Chemicals, peptides, and recombinant proteins

Δ9-Tetrahydrocannabinol (THC) Sigma-Aldrich T-005
Genistein Cayman Chemicals 10005167
Matrigel® Matrix Basement Membrane Growth Factor Reduced Corning 356231
Matrigel® Basement Membrane Matrix Corning 354234
Y-27632 2HCl (ROCK Inhibitor) Selleck Chemicals S1049
CHIR-99021 (CT99021) HCl 5mg Selleck Chemicals S2924
IWR-1 Selleck Chemicals S7086
B-27 Supplement, minus insulin Thermo Fisher Scientific A1895601
B-27 Supplement (50x), serum free Thermo Fisher Scientific 17504044
Recombinant Human FGF-2 PeproTech 100-18B
Recombinant Human VEGF R&D Systems 293-VE-010/CF
EGM-2 Endothelial Cell Growth Medium-2 Bullet Kit Lonza CC-3162
Doxycycline Sigma-Aldrich D3072
Polyethylenimine HCl MAX Polysciences 24765-1
Polybrene Santa Cruz Biotechnology sc-134220
Puromycin Cayman Chemical Company 13884
Oil Red O Sigma-Aldrich O0625
BstXI Thermo Fisher Scientific FD1024
BlpI NEB R0585S
DNA ligation kit Takara Bio 6023
Lipofectamine 2000 Thermo Fisher Scientific 11668019
CellTiter-Glo 2.0 Assay Promega G9241
ROS-Glo™ H2O2 Assay Promega G8820
GTPase-Glo™ Assay Promega V7681
Cell ROX™ Deep Red Reagent, for oxidative stress detection Thermo Fisher Scientific C10422
Calcein-AM R&D Systems 4892-010-01
TRIzol™ Reagent Thermo Fisher Scientific 15596026
RIPA buffer Thermo Fisher Scientific 89901
NuPAGE 4-12% Mini protein gels Thermo Fisher Scientific NP0321BOX
TaqMan™ Universal PCR Master Mix Thermo Fisher Scientific 4305719
TaqMan™ Fast Advanced Master Mix Thermo Fisher Scientific 4444557

Deposited data

Olink and Luminex (https://data.mendeley.com/datasets/s6j8h9yy57/1) Mendeley Data (https://doi.org/10.17632/s6j8h9yy57.1)
Bulk RNA sequencing of EHTs NCBI GSE198578

Experimental models: Cell lines

Human iPSC Line 1 Stanford Cardiovascular Institute (SCVI) Biobank SCVI15
Human iPSC Line 2 SCVI Biobank SCVI113
Human iPSC Line 3 SCVI Biobank SCVI273
Human iPSC Line 4 SCVI Biobank SCVI274
CRISPRi iPSC line Mandegar et al. 2016 Gen1C and Gen2C
Human coronary artery endothelial cells (HCAEC) The American Type Culture Collection (ATCC) PCS-100-020
Human umbilical vein endothelial cells (HUVEC) ATCC CRL-1730
Human cardiac fibroblasts-ventricular (NHCF-V) Lonza CC-2904
Human erythroleukemia cells (HEL92.1.7) ATCC TIB-180
Human neuroblastoma cells (SK-N-FI) ATCC CRL-2142
U-937 monocytes ATCC CRL-1593.2
H7 Human embryonic stem cells Wicell WA07 (H7)
HEK293T packaging cells Takara Bio 632180 Lenti-X™ 293T Cell Line
CB1-expressing Chem-1 cells EMD Millipore HTS019RTA

Experimental models: Organisms/strains

Mouse: wild type The Jackson Laboratory C57BL/6J
Mouse: LDLR knockout The Jackson Laboratory B6.129S7-Ldlr<tm1Her>/J
Mouse: C57BL/6-Apoe em1Narl/Narl (Apoe knockout mice) National Laboratory Animal Center (Taiwan) RMRC13302
Mouse: BALB/cAnN.Cg-Foxn1nu/CrlNarl (Nude mice) National Laboratory Animal Center (Taiwan) RMRC12005

Oligonucleotides

Protospacer sequences of sgRNAs: GGACTAAGCGCAAGCACCTA (control sgRNA); GACAGCGCGAGCGGAGGGAG (CB1 sgRNA#1); GCGCGGGAGACAAGAAGAGG (CB1 sgRNA#2) Addgene #83969 N/A
ON-TARGET plus Human CNR1 (1268) siRNA-SmartPool: GCGAGAAACUGCAAUCUGU (CB1 siRNA#1); GACCAUAGCCAUUGUGAUC (CB1 siRNA#2); GGACAUAGAGUGUGUUUCAUG (CB1 siRNA#3); CAAGAGCACGGUCAAGAUU (CB1 siRNA#4) Dharmacon L-004711-00-0005
ON-TARGETplus Non-targeting Control Pool Dharmacon D-001810-10-20

Recombinant DNA

sgRNA backbone plasmid Addgene #60955
psPAX2 (Lentiviral packaging plasmid) Addgene #12260
pMD2.G (VSV-G envelope expressing plasmid) Addgene #12259

Software and algorithms

ImageJ NIH https://imagej.nih.gov/ij/
R version 3.5.3 The R Project https://www.r-project.org/
BROOD version 3.0 Open Eye Scientific Software N/A
ROCS version 2.3 Open Eye Scientific Software N/A

Other

High fat diet (40% fat, 1.25% cholesterol) Research Diets, Inc D12079B, modified
Osmotic pumps Alzet Model 2006
Feeding needle Fine Science Tools 18065-20
Non-invasive blood pressure system Kent Scientific Corporation CODA-HT4
Silicone rack EHT Technologies C0001
Teflon spacer EHT Technologies C0002
Measurement of lipid profiles in mice Stanford Animal Diagnostic Lab N/A
SWEETLEAD SWEETLEAD Database (Stanford University) N/A
UK Biobank UK Biobank N/A