. 2022 Aug 5;9(8):412. doi: 10.3390/vetsci9080412

Table 1.

Oligonucleotide primers used in this study for PCR procedures.

Species	Primers			Ta, °C	Extension Time, s	Product Size (bp)	Reference
Species	Name	Orientation	Sequence (5′–3′)	Ta, °C	Extension Time, s	Product Size (bp)	Reference
Primers for Direct and Nested PCR
Sarcocystis spp.	SF1	Forward	ATGGCGTACAACAATCATAAAGAA				[15]
	SR8D	Reverse	CATTGCCCATDACTACGCC	55	70	1072	[15]
	SR9	Reverse	ATATCCATACCRCCATTGCCCAT	60	70	1085	[16]
	SR12H	Reverse	AAATACCTTGGTGCCCGTAG	56	60	952	[17]
S. bovifelis	GaBfEF	Forward	ATCAACTTCCTAGGTACAGCGGTATT	56	45	523	[11]
S. bovifelis	GaBfER	Reverse	CCACATCATTGGTGCTTAGTCTAGTA	56	45	523	[11]
S. cruzi	GaCrEF	Forward	GCTATGTATCTACTTACGGCAGGTATC	56	45	608	[11]
S. cruzi	GaCrER	Reverse	GAATATAATGGCCCAGGTAAATAATG	56	45	608	[11]
S. hirsuta	GaHiEF	Forward	GTTGTGCGGTATGAATTATCAACCT	56	45	513	[11]
S. hirsuta	GaHiER	Reverse	GGTAAGAACTGGAATGGTTAATATCAG	56	45	513	[11]
S. arieticanis	GsSariF	Forward	TTCTTGGTATGGCTATTCTTGGACT	65	45	586	[18]
S. arieticanis	GsSariR	Reverse	GATATGTCAATCCAGAGATCGGTAG	65	45	586	[18]
S. tenella	GsStenF	Forward	TACTCGGAGCGGTGAACTTCTTA	63	35	451	[18]
S. tenella	GsStenR	Reverse	ATAGTCACGGCAGAGAAGTAGGAC	63	35	451	[18]
S. capracanis	GsScapF	Forward	AGCGGTAAACTTCCTGGGTACT	63	35	467	[18]
S. capracanis	GsScapR	Reverse	GCCTATCCAGTTGAATATCTTGGT	63	35	467	[18]
Primers for multiplex-nested PCR
1st round
Sarcocystis spp.	SF1	Forward	ATGGCGTACAACAATCATAAAGAA				[15]
S. arieticanis, S. cruzi	SsunR2	Reverse	GTGCCTCCCAGGCTGAAYAG	56	70	1055	[19]
S. bertrami, S. tenella, S. capracanis	SsunR1	Reverse	GTACCGCCCAGGCTGAAYAG	56	70	1055	[18]
S. bovifelis, S. hirsuta	SkatR	Reverse	CAGGCTGAACAGHABTACGA	56	70	1042	[19]
S. miescheriana	SmieF	Forward	ACGCTGTATGCACCACTGAG	56	45	658	Present study
S. miescheriana	SmieR	Reverse	CTGAACAGCGCTACAAATGC	56	45	658	Present study
2nd round
S. bertrami	GsSberF	Forward	GTATGAACTGTCAACGGATGGAGTA	65	35	482	Present study
S. bertrami	GsSberR	Reverse	TCAACATTAGCGAGGTAAATACTATC	65	35	482	Present study
S. miescheriana	GsSmieF	Forward	GTTCCTCGGTATTAGCAGCGTACT	65	35	509	Present study
S. miescheriana	GsSmieR	Reverse	AGTTAAATATTTTAGTGCCCGTTGGA	65	35	509	Present study
Primers for semi-nested PCR
S. bovifelis	VoboF	Forward	GATCGGTATTACTGTTGCACTCATT	58	45	701	Present study
	VoboR	Reverse	AGGCCACATCATTGGTGCTTA	58	45	701	Present study
	GaBfEF	Forward	ATCAACTTCCTAGGTACAGCGGTATT	57	35	521	[11]
S. tenella	VoteF1	Forward	AGCGGTGAACTTCTTAGGAACC	59	35	526	Present study
	VoteR	Reverse	AATAATCCGCTGTTAACGTATGC	59	35	526	Present study
	VoteF2	Forward	CATTGTAATGCTCCTCGACGATA	59	30	401	Present study
S. capracanis	VocaF	Forward	GTAAACTTCCTGGGTACTGTGCTGT	60	35	526	Present study
	VocaR1	Reverse	CCAGTAATCCGCTGTCAAGATAC	60	35	526	Present study
	VocaR2	Reverse	AGTACCCATCACGGTGCCTATC	63	35	500	Present study
Species-specific primers for nested PCR
S. bovifelis	V2bo1	Forward	AACTTCCTAGGTACAGCGGTATTCG	60	40	556	Present study
	V2bo2	Reverse	TGAACAGCAGTACGAAGGCAAC	60	40	556	Present study
	V2bo3	Forward	ATATTTACCGGTGCCGTACTTATGTT	60	30	410	Present study
	V2bo4	Reverse	GCCACATCATTGGTGCTTAGTCT	60	30	410	Present study
S. cruzi	V2cr1	Forward	TACAATGTGCTGTTTACGCTCCA	57	50	776	Present study
	V2cr2	Reverse	GCAATCATGATAGTTACGGCAGA	57	50	776	Present study
	V2cr3	Forward	ACCATCCTGTTCTGTGGTGCTATG	65	30	298	Present study
	V2cr4	Reverse	AAACTACTTTACTGCCTACGGTACTC	65	30	298	Present study
S. hirsuta	V2hi5	Forward	TATGTTGGTTCTGCCGAAGTCAT	60	45	686	Present study
	V2hi6	Reverse	GGTATGGCAATCATTATGGTTACAG	60	45	686	Present study
	V2hi7	Forward	GCACCGTAATATTTCAGGGATGT	60	30	299	Present study
	V2hi8	Reverse	AACCTGCTTGCCGGAGTAAGTA	60	30	299	Present study
S. arieticanis	V2arie1	Forward	CTCTTTGCCGTAGATTCGCTAGTTA	63	55	884	Present study
	V2arie2	Reverse	CAAAGATCGGTAGATATCCAATGC	63	55	884	Present study
	V2arie3	Forward	TAGTTCTTGGCCTGGCTATTCTT	59	25	371	Present study
	V2arie4	Reverse	CTGACCTCCAAAAACTGGCTTAC	59	25	371	Present study
S. tenella	V2te1	Forward	GAGCGGTGAACTTCTTAGGAACC	60	40	537	Present study
	V2te2	Reverse	CCCAATAATCCGCTGTTAACGTA	60	40	537	Present study
	V2te3b	Forward	ATTGTAATGCTCCTCGACGATATG	57	30	314	Present study
	V2te4	Reverse	ATAGTCACGGCAGAGAAGTAGGAC	57	30	314	Present study
S. capracanis	VocaF	Forward	GTAAACTTCCTGGGTACTGTGCTGT	60	40	531	Present study
	VocaR1	Reverse	CCAGTAATCCGCTGTCAAGATAC	60	40	531	Present study
	V2cap3	Forward	ATACCGATCTTTACGGGAGCAGTA	63	30	330	Present study
	V2cap4	Reverse	GGTCACCGCAGAGAAGTACGAT	63	30	330	Present study
S. bertrami	V2ber1	Forward	GTATGAACTGTCAACGGATGGAGTA	58	60	883	Present study
	V2ber2	Reverse	AGAAGCCATGTTCGTGACTACC	58	60	883	Present study
	V2ber3	Forward	GTACTACCTCCTTCCAGTCGGTTC	57	40	600	Present study
	V2ber4	Reverse	CGGGTATCCACTTCAAGTCCAG	57	40	600	Present study
S. miescheriana	V2mie1	Forward	TGCTGCGGTATGAACTATCTACCT	61	60	922	Present study
	V2mie2	Reverse	GCCCAGAGATCCAAATCCAG	61	60	922	Present study
	V2mie3	Forward	CTTGGTTCAACGTTACTCCTCCA	61	30	474	Present study
	V2mie4	Reverse	CTTCGATCCAGCTGAACTAAAGC	61	30	474	Present study

SF1 is specific to genus Sarcocystis. SR8D, SR9, and SR12H are specific to some of the tested species or to some isolates of analyzed species. The remaining primer pairs were designed to be specific to certain Sarcocystis species. R = A or G, D = A or G or T2.4. PCR product purification, sequencing, and sequence analysis.