Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
qPCR primer sequences.
| Gene | 5′ Primer | 3′ Primer |
|---|---|---|
| GPR41 | 5 tcttcaccaccgtctatctcac 3 | 5 cacaagtcctgccaccctc 3 |
| GPR43 | 5 ctgcctgggatcgtctgtg 3 | 5 cataccctcggccttctgg 3 |
| GPR109A | 5 cggtggtctactatttctcc 3 | 5 cccctggaatacttctgatt 3 |
| Olfr78 | 5 gaggaagctcacttttggtttgg 3 | 5 cagcttcaatgtccttgtcacag 3 |
| R18S | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
