Abstract
We investigated the acute and chronic effects of efavirenz, a widely used antiretroviral drug, and CYP2B6 genotypes on the disposition of racemic and stereoisomers of bupropion (BUP) and its active metabolites, 4-hydroxyBUP, threohydroBUP, and erythrohydroBUP. The primary objective of this study was to test how multiple processes unique to the efavirenz-CYP2B6 genotype interaction influence the extent of efavirenz-mediated drug-drug interaction with the CYP2B6 probe substrate BUP. In a three-phase, sequential, open-label study, healthy volunteers (N = 53) were administered a single 100 mg oral dose of BUP alone (control phase), with a single 600 mg oral efavirenz dose (inhibition phase), and after 17 days pretreatment with efavirenz (600 mg/d) (induction phase). Compared with the control phase, we show for the first time that efavirenz significantly decreases (by 11%–26%) and chronically increases (by 24%–61%) the exposure of hydroxyBUP and its diastereomers, respectively, and the extent of these interactions were CYP2B6 genotype dependent. Chronic efavirenz enhances the elimination of racemic BUP and its enantiomers (by 51%–56%) as well as of threo- and erythrohydroBUP and their diastereomers (by 34%–58%), suggesting additional novel mechanisms underlying efavirenz interaction with BUP. The effects of efavirenz and genotypes were nonstereospecific. In conclusion, acute and chronic administration of efavirenz inhibits and induces CYP2B6 activity. Efavirenz-BUP interaction is complex, involving time- and CYP2B6 genotype–dependent inhibition and induction of primary and secondary metabolic pathways. Our findings highlight important implications to the safety and efficacy of BUP, study design considerations for future efavirenz interactions, and individualized drug therapy based on CYP2B6 genotypes.
SIGNIFICANCE STATEMENT
The effects of acute and chronic doses of efavirenz on the disposition of racemic and stereoisomers of bupropion (BUP) and its active metabolites were investigated in healthy volunteers. Efavirenz causes an acute inhibition but chronic induction of CYP2B6 in a genotype-dependent manner. Chronic efavirenz induces BUP reduction and the elimination of BUP active metabolites. These data reveal novel mechanisms underlying efavirenz drug-drug interaction (DDI) with BUP and provide important insights into time- and CYP2B6 genotype–dependent DDIs.
Introduction
Efavirenz-based regimens for HIV/AIDs therapy are extensively used worldwide (Gulick et al., 2004), particularly in resource-limited countries (Cluck et al., 2016; https://www.who.int/publications/i/item/9789240031593), and millions of stabilized HIV patients continue taking these regimens (Vitoria et al., 2018). However, safe and effective therapy with efavirenz is compromised by narrow therapeutic range (Marzolini et al., 2001), substantial interpatient pharmacokinetic variability (Rotger et al., 2007; Holzinger et al., 2012), and numerous drug-drug interactions (DDIs) that increase the risk for treatment failure or adverse effects of coadministered drugs (https://packageinserts.bms.com/pi/pi_sustiva.pdf; https://clinicalinfo.hiv.gov/en/guidelines/hiv-clinical-guidelines-adult-and-adolescent-arv/whats-new-guidelinesAdultandAdolescentGL.pdf).
CYP2B6 is the principal human hepatic clearance mechanism for efavirenz, with small contributions from other accessory enzymes (Ward et al., 2003; Desta et al., 2007; Belanger et al., 2009; Ogburn et al., 2010). Pharmacogenetic (Desta et al., 2019; Desta et al., 2021) and DDI studies (Cho et al., 2016; Desta et al., 2016) have now established the major role CYP2B6 plays in efavirenz clearance and effects.
Efavirenz increases the expression of several drug disposition genes via activation of the constitutive androstane receptor (Faucette et al., 2007; Meyer zu Schwabedissen et al., 2012) and pregnane X receptor (Sharma et al., 2013). Thus, induction of drug metabolism and transport explain many clinically observed efavirenz-mediated DDIs. For example, chronic administration of efavirenz induces CYP2B6 expression (Meyer zu Schwabedissen et al., 2012), thereby enhancing its own metabolism (“autoinduction”) (Zhu et al., 2009; Ngaimisi et al., 2010; Metzger et al., 2013) and the elimination of other CYP2B6 substrates such as methadone (Clarke et al., 2001; Kharasch et al., 2012) and bupropion (BUP) (Robertson et al., 2008), with large interindividual variability. This variability in autoinduction is mainly dictated by variants in the CYP2B6 gene: no or minimal autoinduction in poor metabolizer of CYP2B6, resulting in excessive accumulation of efavirenz, and efficient autoinduction in normal and intermediate metabolizers of CYP2B6 (Ngaimisi et al., 2011; Metzger et al., 2013; Desta et al., 2019; Desta et al., 2021). The interplay of CYP2B6 genotypes and efavirenz autoinduction is a major determinant of CYP2B6 activity and efavirenz’s exposure, effects, and DDIs. For example, poor metabolizer of CYP2B6 have been shown to be at greater risk for efavirenz inhibition and induction DDI risks and treatment failure for drugs metabolized by enzymes other than CYP2B6 (e.g., contraceptives, lumefantrine, caffeine) (Habtewold et al., 2013; Maganda et al., 2016; Neary et al., 2017; Zakaria and Badhan, 2018; Metzger et al., 2019; Neary et al., 2019; Haas et al., 2020). However, how CYP2B6 genotypes may influence variability in CYP2B6 induction by efavirenz remains unknown. In addition, our previous data show that efavirenz is a potent inhibitor of CYP2B6 in vitro (Xu and Desta, 2013), and the CYP2B6.6 protein is more susceptible to metabolic inhibition than the CYP2B6.1 protein (Xu et al., 2012), but the in vivo relevance of these in vitro findings remains unknown.
4-Hydroxylation of racemic, R- and S-BUP is selectively catalyzed by CYP2B6 (Faucette et al., 2000; Hesse et al., 2000; Coles and Kharasch, 2008; Kharasch et al., 2008; Benowitz et al., 2013) and this reaction serves as a valid marker of CYP2B6 activity. Thus, the main aim of this study was to test the hypotheses that acute and chronic administration of efavirenz causes inhibition and induction of CYP2B6 activity, respectively, as measured by BUP 4-hydroxylation, and that CYP2B6 genotypes dictate the extent of the efavirenz-CYP2B6 interaction.
Chronic administration of efavirenz decreases racemic BUP exposure by approximately 55%, with evidence of consequent induction of 4-hydroxylation to 4-hydroxyBUP (OHBUP) (Robertson et al., 2008). However, the fraction of BUP metabolized via 4-hydroxylation is relatively small (∼21%) (Sager et al., 2016) to mediate this large effect of efavirenz on BUP exposure. BUP keto-reduction to threohydroBUP (THBUP) and erythrohydroBUP (EHBUP) by 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1) and/or other carbonyl reductases is another important elimination pathway of BUP (Meyer et al., 2013; Connarn et al., 2015; Bamfo et al., 2022). It is conceivable that efavirenz reduces BUP exposure primarily via indiction of this important elimination pathways, but this possibility has not been tested clinically. In addition, BUP (a chiral drug) is clinically used as a racemic mixture of R- and S-BUP that also undergo marked stereospecific hydroxylation and keto-reduction (Masters et al., 2016a; Sager et al., 2016; Costa et al., 2019), generating multiple pharmacologically active diastereomers that contribute to BUP’s clinical effect, adverse effects, and CYP2D6-dependent DDIs (Silverstone et al., 2008; Sager et al., 2017; Dash et al., 2018; Costa et al., 2019). Yet, the effect of efavirenz on the stereoselective disposition of BUP is not known. Thus, the secondary aim was to test the effect of efavirenz and CYP2B6 genotypes on the disposition of racemic and stereoisomers of BUP and its active metabolites (OHBUP, THBUP, and EHBUP).
Methods
Clinical Study Protocol
In this study, healthy volunteers genotyped for variants in the CYP2B6 gene were administered a cocktail of selective probe drugs for CYP2B6 (BUP), CYP2C8 (montelukast), and OATP1B1/3 and BCRP (rosuvastatin) on three occasions: at baseline (control phase), with a single 600 mg dose of efavirenz (acute inhibition), and after treatment with 600 mg/d efavirenz for 17 days (inhibition/induction). In this manuscript, the data describing the effects of efavirenz and CYP2B6 genetic variation on racemic and stereoselective pharmacokinetics of BUP and its metabolites are reported, whereas details of the rationale for studying CYP2C8, OATP1B1/3 and BCRP and the findings regarding efavirenz’s effects on montelukast and rosuvastatin disposition will be subject to future publications.
Study Participants
Healthy male and nonpregnant (and nonbreastfeeding) female (n = 24) and male (n = 29) volunteers (18–49 years old), weighing ≥50 kg and within 32% of their ideal body weight and determined to be healthy through preenrollment screening that included medical histories, vital signs and electrocardiography, demographic variables, and standard laboratory blood and urine tests, were enrolled and completed all study phases. Male and female gender is based on self-identification of the subjects during recruitment and may not necessarily correspond with biologic female and male as sex at birth was not established. Complete inclusion and exclusion criteria are provided in Supplemental Table 1. The Indiana University School of Medicine Institutional Review Board approved the study. Subjects signed an institutional review board–approved written informed consent prior to participation in this study after they read the informed consent and the study was carefully explained to them. During the screening, blood (∼15 ml) and urine samples were collected from each subject for routine clinical laboratory tests. An additional ∼10 ml blood sample was obtained from each subject to extract genomic DNA for genotyping purposes. Subjects were evaluated at a single site: the Clinical Research Center (CRC) of the Indiana Clinical Translational Sciences Institute, located at the Indiana University Hospital. The trial was registered at http://www.clinicaltrials.gov (clinicaltrials.gov identifier: NCT02401256).
Study Design
This clinical study was carried out as part of a single-site, three-phase, sequential, open-label prospective trial that was designed to test the interplay of variants in the CYP2B6 gene and simultaneous autoinhibition/autoinduction of efavirenz metabolism on efavirenz exposure and efavirenz-mediated drug interactions with CYP2B6, CYP2C8, and OATP1B1 substrates. Healthy volunteers genotyped for common and functionally relevant variants in the CYP2B6 gene were administered a cocktail of selective probe drugs for CYP2B6 (100 mg BUP, immediate release formulation), CYP2C8 (10 mg montelukast), and OATP1B1/3 and BCRP (5 mg rosuvastatin) on three occasions: at baseline (control phase), with a single 600 mg dose of efavirenz (acute inhibition), and after treatment with 600 mg/d efavirenz for 17 days (inhibition/induction). Volunteers who met all eligibility criteria were enrolled and participated in three phases with a total of three inpatient days (phase 1, 2, and 3) and a total of 15 outpatient visits. The study design is depicted in Fig. 1. The cocktail probe drugs (BUP, montelukast, and rosuvastatin) were administered as a single and lowest-available dose on three occasions (and served as their own controls), with washout periods of 10, 6, and 14 days, respectively. The washout period was adequate to avoid carryover effects, if any, on mutual interactions or their interaction with efavirenz because each probe has a relatively short elimination half-life. The probe substrates have no common pathway that is catalyzed by the same enzyme or transported by the same drug transporters (montelukast is a CYP2C8 substrate, rosuvastatin is transported by OATP1B1/3 and BCRP, and BUP is metabolized by CYP2B6 and carbonyl reductases). Therefore, mutual interactions of the probe substrates are highly unlikely. All study days and visits were performed at the CRC. We report here the data that relate to the effects of efavirenz and CYP2B6 genetic variation on racemic and stereoselective pharmacokinetics of BUP and its metabolites in this trial.
Fig. 1.
Clinical study design. *Bupropion (100 mg) given as part of a probe drug cocktail that included montelukast and rosuvastatin.
Phase 1 (day 1, control phase): subjects arrived at the CRC in the morning (about 7 AM) after an overnight fast. An intravenous catheter was inserted in one arm for blood collection. A urine pregnancy test (if female) was obtained. Predose blood (∼10 ml) and urine samples were also obtained. Assessment of the subject’s central nervous system (CNS) symptoms were made using the CNS symptom rating questionnaire that has been developed by the National Institute of Allergy and Infectious Diseases Adult AIDs Clinical Trial group (Clifford et al., 2005), with slight modification as follows. Participants in our prior trial with efavirenz (clinicaltrials.gov identifier: NCT00668395) recorded two new CNS symptoms (aggressive behavior and irritability) in their home diaries and during inpatient observation after efavirenz administration. Thus, these previously unidentified CNS symptoms were included in the modified CNS symptom rating questionnaire. Then, a cocktail of probe drugs (100 mg BUP, 10 mg montelukast, and 5 mg rosuvastatin) was administered with ∼200 ml water (control phase). A standard meal was served 3 hours after dosing, and volunteers were otherwise allowed a regular diet. Blood samples (∼10 ml) were collected via the intravenous catheter (0.5, 1, 1.5, 2, 2.5, 3, 4, 6, 8, 10, 12, 16, and 24 hours) or peripheral needle stick (48 and 72 hours) for pharmacokinetic evaluation. All urine voided during the 24-hour CRC stay was collected at intervals of 0–12 and 12–24 hours for further metabolism studies. In addition, the 24-48–hour urine interval was collected at home. Approximately 20 minutes before each blood sample collection, subjects filled out the questionnaire. As part of safety measures, sitting blood pressure, respiration rate, oxygen saturation (per oximeter), pulse rate, oral temperature (°F), and electrocardiography were recorded every 6 hours during the 24-hour inpatient stay at the CRC. All other drug-related side effects were recorded. Subjects were regularly monitored and questioned for any unusual feelings and were requested to report immediately any unusual feelings. Plasma was separated from blood collections by centrifugation at 3000 rpm. Two 10 ml urine aliquots were saved from each urine collection interval after the total urine collection volume was recorded. Plasma and urine samples were stored at −80°C until analyses.
Phase 2 (day 11, inhibition phase): subjects were readmitted to the CRC for a second time after an overnight fast and underwent the same procedures as in phase 1 except the following differences. First, a cocktail of selective probe drugs was administered 1 hour after dosing with a single 600 mg oral dose of efavirenz to minimize interference of efavirenz with the absorption of the cocktail drugs (or vice versa), and extra blood samples were collected at 30 minutes and 1 hour before cocktail administration. Second, additional 96- and 120-hour blood samples were collected after efavirenz dosing (compared with phase 1) to better capture the long elimination half-life of efavirenz, whereas sampling for 72 hours in phase 1 (control phase) covers more than 3 to 4 times the termination elimination half-life of the probe substrates and deemed sufficient.
Phase 3 (inhibition and induction phase): immediately after the 120-hour blood sampling of phase 2 (day 16), home efavirenz treatment started on the same day that evening, and subjects continued taking efavirenz (600 mg oral dose) every evening for 17 consecutive days (16–32 days). On day 16, subjects were supplied with a dosing diary to record the date and time of efavirenz ingestion and any side effects they might experience. Then, volunteers were readmitted to the CRC for a third time in the morning of day 33 after an overnight fast. A second urine pregnancy test was performed. A cocktail of selective probe drugs was given 1 hour after the administration of the last dose of efavirenz (600 mg). All other procedures were identical to those in phase 2. The total duration of the study was 38 days. On day 38, an exit exam was performed consisting of a repeat of the screening laboratory tests (including blood and urine tests). The dosing diary and medication bottles with leftover efavirenz (if any) were collected and counted for assessment of compliance.
Quantification of BUP and Its Metabolites in Plasma
Chemicals and Reagents
Racemic-, R- and S-bupropion (BUP), racemic hydroxybupropion (OHBUP), (2R,3R)-hydroxybupropion (RR-OHBUP), (2S,3S)-hydroxybupropion (SS-OHBUP), racemic erythrohydrobupropion (EHBUP), racemic threohydrobupropion (THBUP), (1R,2R)-threohydrobupropion (RR-THBUP), and (1S,2S)-threohydrobupropion (SS-THBUP) were purchased from Toronto Research Chemicals Inc. (Toronto, Ontario, Canada). Optically pure standards for racemic EHBUP [(1R,2S)-erythrohydrobupropion (RS-EHBUP), (1S,2R)-erythrohydro (SR-EHBUP)] were not commercially available; thus, we used racemic EHBUP. Characterization of diastereomers of EHBUP has been described previously (Gufford et al., 2016; Masters et al., 2016a; Masters et al., 2016b). Nevirapine (internal standard) was supplied through the National Institutes of Health AIDS Research and Reference Reagent Program (Germantown, MD). Acetaminophen, which was used as an internal standard in samples from 15 subjects, was purchased from Sigma Aldrich Chemical Co. (St. Louis, MO). Laboratory water was prepared for liquid chromatography–tandem mass spectrometry (LC-MS/MS) applications using a Nanopure Infinity UV system (Barnsteas/Thermolyne, Dubuque, IA). Glycine was purchased from Sigma-Aldrich (St. Louis, MO). Plasma from human whole blood (tri-K EDTA, male, drug free, nonsmoker) for standard and quality control preparations was purchased from Biologic Specialty Corp. (Colmar, PA). Methanol, acetic acid, ethyl acetate, ammonium bicarbonate, ammonium hydroxide, and sodium hydroxide were purchased from Fisher Scientific Company LLC (Hanover Park, IL). All the other solvents and chemicals were purchased from Fishers Scientific (Hampton, NH) and were of high-performance LC/MS/MS grade or higher.
High-Performance LC-MS/MS Method Development
Plasma BUP and its metabolites as well as the corresponding R- and S-BUP, RR- and SS-OHBUP; RR- and SS-THBUP, and RS- and SR- EHBUP were initially quantified in 15 subjects using a validated chiral LC-MS/MS (5500 QTRAP AB Sciex, Framingham, MA) as previously reported (Masters et al., 2016a). Briefly, 50 µL of plasma was used for the assay with acetaminophen added as the internal standard, followed by liquid-liquid extraction with ethyl acetate. Separation of all analytes was achieved using a Lux Cellulose-3 chiral column, 250 × 4.6 mm, 3 μm (Phenomenex, Torrance, CA). The assay details are as listed in our previous publication (Masters et al., 2016a).
However, due to the prolonged separation time required for this method (Masters et al., 2016a), we developed a new chiral LC-MS/MS method with better chromatographic resolution of the stereoisomers and short retention times of BUP and its metabolites. In brief, an API 3200 triple quadrupole mass spectrometer (Applied Biosystems, Foster City, CA) equipped with an electrospray ionization source and coupled to a high-performance liquid chromatography system consisting of two LC-20AD pumps, a SIL-20AHT UFLC autosampler, a DGU-20A3 degasser, and a CBM-20A system controller (Shimadzu, Columbia, MD) was used. Chromatographic separation was achieved using an AMP (amphetamine) column (150 × 4.6 mm i.d.; 3 µm particle size; Phenomenex, Torrance, CA) and mobile phase consisting of methanol (mobile phase B) and 5 mM ammonium bicarbonate (pH 11 adjusted by ammonium hydroxide, mobile phase A) using the following gradient: initial conditions was 60% mobile phase B between 0.01–3 minutes; changed to 75% mobile phase B after 3 minute followed by a linear gradient to 95% mobile phase B between 3.01 and 12 minutes; and then re-equilibrated to initial conditions at 12.01 minutes and continued until 13 minutes using a flow rate of 0.8 ml/min. Data acquisition and processing were performed using Analyst software (version 1.5.1, AB SCIEX). Analyte concentrations were quantified using Analyst software by interpolation from matrix-matched calibration curves. All data were collected in positive ion mode. Parameters were set according to standard drugs flow injection analysis results. The responses of the analytes were optimized at a source temperature of 600°C under unit resolution for quadrupole 1 and 3. In addition, the analytes were given a dwell time of 100 ms and a settling time of 10 ms. The ion spray voltage was 5500 V, and the interface heater was on. Optimal gas pressures for all the analytes were: collision gas medium, curtain gas 25, ion source gas (1) 35, and ion source gas (2) 40. Multiple reaction monitoring was used to measure Q1/Q3 transitions for: BUP, R- and S-BUP at 240.1/184.0; OHBUP, RR- and SS-OHBUP at 255.9/238.0; EHBUP, RS- and SR-EHBUP as well as THBUP, RR- and SS-THBUP at 241.9/168.0; and nevirapine (internal standard) at 267.5/226.1. This new LC-MS/MS method was used to quantify plasma samples from the remaining 38 subjects.
Plasma Liquid-Liquid Extraction
An aliquot of each plasma sample (200 µL) was transferred to a culture tube with screw cap, and 25 µl of 500 ng/ml nevirapine was added as internal standard. After vortex mix, 200 µL glycine/NaOH (pH 11.3) followed by 6 mL ethyl acetate was added for liquid-liquid extraction. The sample was shaken for 15 minutes and then centrifuged at 3600 rpm at 4°C for 10 minutes. The resulting supernatant was transferred to a test tube and dried under a vacuum. The dried sample was reconstituted in 50 µL methanol, and 10 µL was injected into the LC-MS/MS system. Matrix-mached calibration curves were generated by addition of known concentrations of authentic standards into blank human plasma. After the addition of internal standards, standards were extracted as described above. Quality controls were run in parallel. The standard curves were linear over the range of 0.1–1000 ng/ml. Inter- and intraday assay accuracy for the new LC/MS/MS method was evaluated using Quantitate software. Standard and quality-control samples were deemed acceptable if within 20% and 10% of the nominal value, respectively, whereas the precision was >90% (% CV < 10). The accuracy and precision of the old assay was described in our earlier publication (Masters et al., 2016a).
CYP2B6 Genotyping
Genomic DNA was extracted at the Indiana University Clinical Translational Sciences Laboratory from whole blood using standard protocol. DNA CYP2B6 genotyping for rs3745274 (516G>T,Q172H), rs28399499 (983T>C, I328T), and rs2279343 (785A>G, K262R) was performed by use of the predeveloped TaqMan Assay-Reagents Allelic Discrimination Kits (rs3745274 and rs28399499) according to the supplier's instructions (Applied Biosystems, Foster City, CA) or by use of a custom TaqMan Genotyping Assay after first amplifying exon 5 with primers 5′‐CTCTCTCCCTGTGACCTGCTA‐3′ (forward) and 5′‐CTCCCTCTGTCTTTCATTCTGTC‐3′ (reverse) (Integrated DNA Technologies, Coralville, IA) (rs2279343} as described by our previous publications (Robarge et al., 2016; Burgess et al., 2017; Metzger et al., 2019). Polymerase chain reaction was performed on BioRad iCycler and QuantStudio 12K Flex real-time polymerase chain reaction instruments. CYP2B6 star allele designations were assigned in accordance with the Pharmacogene Variation Consortium (https://www.pharmvar.org/gene/CYP2B6). Genotype groups considered for the analysis were normal metabolizer (NM) (*1/*1 genotype, n = 19), intermediate metabolizer (IM) (*1/*6 genotype, n = 27), and poor metabolizer (PM) (*6/*6* genotype, n = 6).
Pharmacokinetic Analysis
Noncompartmental analysis of data was performed using Phoenix WinNonlin (version 7.0, Pharsight Corp., Cary, NC). Pharmacokinetic outcomes for analysis included: terminal elimination rate constant (λz), terminal elimination half-life (t1/2) , maximum plasma concentration (Cmax), time to Cmax (tmax), area under the plasma concentration time curve from zero to infinity (AUC0–∞), apparent volume of distribution (Vd/F), and apparent oral clearance (CL/F). The Cmax, tmax, and last measured concentration (Clast) were recovered directly from the concentration-time profile. The λz was estimated by linear regression of the terminal portion of the log-transformed concentration-time profile using at least three data points. The following parameters were estimated as follows: t1/2 = (0.693/λz); CL/F = dose/AUC0-∞; and Vd/F = (CL/F)/λz. Area under the curve from time zero to Clast (AUC0-t) was determined using the trapezoidal rule with linear up/log down interpolation. AUCextrapolated (AUCt-∞) is calculated from the ratio of Clast to λz. AUC0–∞ was calculated as the sum of AUC0-t + AUCt-∞. AUC0–∞ values reported for analytes where the extrapolation percentage was more than 30% are denoted accordingly. Statistical data comparisons between the pharmacokinetic outcomes were evaluated using the two one-sided testing procedure according to the 2001 U.S. Food and Drug Administration Guidance to Industry on Statistical Approaches to Establishing Bioequivalence (https://www.fda.gov/media/70958/download). This approach is based on testing whether the 90% confidence interval (CI) for the ratio of the averages (population geometric means) of the pharmacokinetic measures (average bioequivalence) were comparable between the treatment groups, i.e., within 80%–125% for the ratio of treatment averages. A P value < 0.05 was considered statistically significant.
Results
The enrollment report is depicted in Supplemental Fig. 1 and shows that 53 subjects completed the entire study phase, and 17 subjects partially completed the study phases. Data from those participants who fully completed all phases of the study are presented, and the demographic characteristics of these participants are listed in Supplemental Table 2.
Effect of Efavirenz onthe Disposition of Racemic BUP and Its Metabolites
Racemic BUP and metabolite concentration-time profiles and the corresponding pharmacokinetic parameters derived (n = 53 healthy volunteers) following a single oral dose of BUP (100 mg) given alone (control phase) or 1 hour after a single oral efavirenz (600 mg) dose (inhibition phase) or following 17-day treatment with efavirenz (induction phase) are presented in Fig. 2. In Table 1, the corresponding pharmacokinetic parameters (geometric mean and 90% CI) in the control, inhibition, and induction phases as well as the geometric mean ratios (GMR) in percent with 90% CI for the inhibition phase (inhibition/control) and induction phase (induction/control) are shown.
Fig. 2.
Racemic bupropion (BUP) and metabolites concentration-time profiles (n = 53 healthy volunteers) following a single oral dose of bupropion (100 mg) given alone (Control), 1 hour after a single oral efavirenz (600 mg) dose (Inhibition), or following 17-day treatment with efavirenz (Induction). Symbols and error bars denote geometric means and the limits of the 95% confidence interval, respectively. Inset, represent concentrations up to 24-hour post dosing.
TABLE 1.
Pharmacokinetic parameters of racemic bupropion and its metabolites
| Geometric Mean [90% CI] | Geometric Mean Ratio % [90% CI] | |||||
|---|---|---|---|---|---|---|
| Control Phase | Inhibition Phase | Induction Phase | Inhibition/Control | Induction/Control | ||
| Bupropion | ||||||
| AUC0–24 (nM*h) | 3400 [3070–3750] | 3330 [3020–3680] | 1530 [1330–1760] | 98 [90–107] | 45 [41–49] | |
| AUC0–∞ (nM*h) | 4160 [3740–4620] | 4140 [3680–4660] | 1860 [1560–2220] | 100 [90–111] | 45 [40–50] | |
| Cmax (nM) | 905 [809–1010] | 891 [782–1010] | 475 [399–566] | 98 [86–112] | 52 [46–60] | |
| t1/2 (h) | 14.8 [13.2–16.5] | 15.5 [13.1–18.2] | 15.2 [12.5–18.7] | 105 [91–120] | 103 [90–119] | |
| Hydroxybupropion | ||||||
| AUC0–24(nM*h) | 25,400 [22,200–29,000] | 20,500 [17,800–23,600] | 31,700 [26,900–37,500] | 81 [74–88] | 125 [115–136] | |
| AUC0–∞(nM*h) | 47,600 [41,600–54,300] | 42,400 [36,800–48,800] | 46,200 [38,700–55,000] | 89 [82–97] | 97 [89–106] | |
| Cmax(nM) | 1700 [1500–1930] | 1270 [1110–1450] | 2480 [2110–2900] | 75 [68–81] | 146 [134–159] | |
| t1/2 (h) | 18.9 [17.7–20.1] | 19.2 [17.9–20.6] | 14.6 [13.2–16.2] | 102 [93–111] | 78 [71–85] | |
| Erythrohydrobupropion | ||||||
| AUC0–24 (nM*h) | 1590 [1440–1750] | 1540 [1390–1700] | 1000 [883–1140] | 97 [91–103] | 63 [59–67] | |
| AUC0–∞ (nM*h) | 3270 [2900–3670] | 3270 [2890–3700] | 1710 [1480–1970] | 100 [93–108] | 52 [48–56] | |
| Cmax (nM) | 107 [97.2–117] | 105 [94.9–117] | 78.4 [68.7–89.4] | 99 [92–107] | 74 [68–79] | |
| t1/2 (h) | 22.5 [21–24.2] | 21.1 [19.7–22.7] | 16.3 [14.9–17.8] | 94 [86–102] | 72 [66–79] | |
| Threohydrobupropion | ||||||
| AUC0–24 (nM*h) | 8050 [7210–9000] | 8350 [7460–9360] | 5180 [4540–5920] | 104 [98–110] | 64 [61–68] | |
| AUC0–∞ (nM*h) | 20,000 [17,600–22,800] | 20,100 [17,800–22,700] | 10,000 [8720–11,600] | 100 [93–108] | 50 [46–54] | |
| Cmax (nM) | 667 [596–747] | 754 [677–840] | 537 [467–617] | 113 [104–123] | 80 [74–87] | |
| t1/2 (h) | 35.4 [32.2–39] | 33 [30.3–36] | 27.5 [24.9–30.3] | 93 [84–104] | 78 [70–86] | |
AUC, Cmax, Tmax, and t1/2 determined via noncompartmental analysis of untransformed data. Ratios and corresponding confidence intervals calculated using Phoenix WinNonlin (v7.0); confidence intervals excluding 100% considered statistically significant.
In the inhibition phase, GMR values for the exposure (Cmax, and area under the plasma concentration time curve (AUC) from zero to 24 hours (AUC0–24) and zero to infinity(AUC0–∞) of racemic OHBUP was slightly but significantly decreased (by 11%–25%) when compared with the control phase; no difference was noted in t1/2. The 90% CI of the GMR values for any of the pharmacokinetic parameters of BUP, EHBUP, and THBUP were within the no-effect boundaries (80%–125%) except for a slight increase in THBUP (Fig. 2; Table 1).
Conversely, the GMR values for AUC0–24 and Cmax of OHBUP was significantly increased (by 25% and 46%, respectively), and t1/2 was significantly shortened (by 22%) in the induction phase compared with the control phase; no difference was observed regarding AUC0–∞. In contrast, the GMR values for the plasma exposure (AUC0–24, AUC0–∞, and Cmax) of BUP, THBUP, and EHBUP in the induction phase were all significantly lower compared with the control phase (by 20%–55%), and half-lives were shortened, except that of BUP, which did not change significantly (Fig. 2; Table 1).
Effect of Efavirenz on Stereoselective Disposition of BUP and Its Metabolites
Concentration-time profiles and the corresponding pharmacokinetic parameters (n = 53 healthy volunteers) of stereoisomers of BUP and its metabolites following the control, inhibition, and induction phases are shown in Fig. 3. In Table 2, the corresponding pharmacokinetic parameters of all phases as well as the GMR in percent with 90% CI for the inhibition phase (inhibition/control) and induction phase (induction/control) are shown.
Fig. 3.
Stereoselective bupropion (BUP) and metabolite concentration-time profiles (n = 53 healthy volunteers) following a single oral dose of bupropion (100 mg) given alone (Control), 1 hour after a single oral efavirenz (600 mg) dose (Inhibition), or following 17-day treatment with efavirenz (Induction). Symbols and error bars denote geometric means and the limits of the 95% confidence interval, respectively. Inset, represent concentrations up to 24-hour post dosing.
TABLE 2.
Stereoselective bupropion pharmacokinetic outcomes
| Geometric Mean [90% CI] | Geometric Mean Ratio % [90% CI] | ||||
|---|---|---|---|---|---|
| Control Phase | Inhibition Phase | Induction Phase | Inhibition/ Control | Induction/ Control | |
| (R)-bupropion | |||||
| AUC0–24 (nM*h) | 2750 [2490–3040] | 2620 [2370–2900] | 1220 [1060–1400] | 95 [87–104] | 44 [40–48] |
| AUC0–∞ (nM*h) | 3360 [3040–3710] | 3220 [2880–3590] | 1470 [1250–1730] | 96 [87–106] | 44 [40–48] |
| Cmax (nM) | 726 [649–812] | 681 [595–780] | 371 [310–443] | 94 [82–107] | 51 [45–58] |
| t1/2 (h) | 14.9 [13.5–16.5] | 16.2 [14.1–18.7] | 14.6 [12.1–17.5] | 109 [96–123] | 98 [86–111] |
| (S)-bupropion | |||||
| AUC0–24 (nM*h) | 615 [544–696] | 678 [600–766] | 302 [258–355] | 110 [100–121] | 49 [45–54] |
| AUC0–∞ (nM*h) | 784 [682–901] | 863 [750–993] | 382 [306–476] | 110 [97–125] | 49 [43–55] |
| Cmax (nM) | 175 [153–200] | 195 [168–227] | 100 [83.6–120] | 112 [97–129] | 57 [50–66] |
| t1/2 (h) | 14.1 [11.9–16.8] | 15 [12.6–17.8] | 13.8 [10.5–18.2] | 106 [89–127] | 98 [82–117] |
| (RR)-hydroxybupropion | |||||
| AUC0–24 (nM*h) | 18,400 [16,900–20,000] | 14,800 [13,500–16,300] | 23,000 [20,500–25,900] | 81 [74–88] | 125 [115–136] |
| AUC0–∞ (nM*h) | 34,800 [31,900–37,900] | 31,100 [28,300–34,100] | 33,600 [29,700–38,100] | 89 [82–98] | 97 [88–106] |
| Cmax (nM) | 1230 [1120–1330] | 912 [828–1010] | 1780 [1590–2000] | 74 [68–81] | 146 [134–159] |
| t1/2 (h) | 19.1 [17.9–20.3] | 19.5 [18.3–20.8] | 14.4 [13.1–15.7] | 102 [94–111] | 75 [69–82] |
| (SS)-hydroxybupropion | |||||
| AUC0–24 (nM*h) | 1190 [1070–1320] | 1010 [898–1130] | 1480 [1300–1670] | 84 [77–92] | 124 [113–136] |
| AUC0–∞ (nM*h) | 1850 [1670–2040] | 1640 [1460–1840] | 1870 [1660–2120] | 89 [81–98] | 102 [92–112] |
| Cmax (nM) | 98.2 [87.5–110] | 78.5 [68.8–89.6] | 158 [137–183] | 80 [72–89] | 161 [145–179] |
| t1/2 (h) | 15.2 [14.2–16.3] | 16.4 [15.1–17.9] | 12.6 [11.1–14.4] | 108 [95–121] | 83 [74–94] |
| (SR)-erythrohydrobupropion | |||||
| AUC0–24 (nM*h) | 900 [777–1040] | 859 [739–999] | 556 [466–662] | 95 [89–102] | 62 [58–66] |
| AUC0–∞ (nM*h) | 1780 [1430–2200] | 1730 [1390–2140] | 899 [722–1120] | 97 [91–104] | 51 [47–54] |
| Cmax (nM) | 67.1 [61.6–73.2] | 63.1 [57–69.9] | 46.2 [40.5–52.7] | 94 [87–102] | 69 [64–75] |
| t1/2 (h) | 20.1 [18–22.5] | 19.4 [17.7–21.3] | 16.4 [14.7–18.2] | 96 [86–108] | 81 [72–91] |
| (RS)-erythrohydrobupropion | |||||
| AUC0–24 (nM*h) | 490 [413–582] | 512 [433–604] | 330 [276–395] | 104 [98–111] | 67 [63–72] |
| AUC0–∞ (nM*h) | 808 [651–1000] | 909 [727–1140] | 476 [384–590] | 113 [104–122] | 59 [54–64] |
| Cmax (nM) | 41.7 [35.8–48.6] | 43.3 [37–50.6] | 31.6 [26.8–37.2] | 104 [96–113] | 76 [70–82] |
| t1/2 (h) | 16.1 [14.6–17.9] | 16.7 [14.1–19.6] | 12.9 [11.6–14.4] | 103 [92–116] | 80 [71–90] |
| (RR)-threohydrobupropion | |||||
| AUC0–24 (nM*h) | 4330 [3940–4760] | 4070 [3690–4500] | 2610 [2330–2930] | 94 [89–100] | 60 [57–64] |
| AUC0–∞ (nM*h) | 165,00 [14,400–19,000] | 15,300 [13,600–17,300] | 7020 [6140–8030] | 93 [85–101] | 42 [39–46] |
| Cmax (nM) | 242 [220–268] | 233 [212–257] | 166 [147–186] | 96 [90–103] | 68 [64–73] |
| t1/2 (h) | 47.9 [43.4–52.8] | 39.4 [36.2–42.8] | 31.9 [29.4–34.6] | 82 [74–92] | 67 [60–74] |
| (SS)-threohydrobupropion | |||||
| AUC0–24 (nM*h) | 3430 [2930–4020] | 4040 [3480–4690] | 2420 [2040–2880] | 118 [109–127] | 71 [65–76] |
| AUC0–∞ (nM*h) | 4080 [3400–4910] | 4860 [4090–5780] | 2710 [2250–3270] | 119 [110–129] | 66 [62–72] |
| Cmax (nM) | 468 [411–532] | 550 [489–619] | 387 [333–451] | 118 [107–129] | 83 [75–91] |
| t1/2 (h) | 9.86 [9.03–10.8] | 13.3 [11.6–15.2] | 13.1 [11.2–15.4] | 135 [117–155] | 133 [116–153] |
AUC, Cmax, Tmax, and t1/2 determined via noncompartmental analysis of untransformed data. Ratios and corresponding confidence intervals calculated using Phoenix WinNonlin (v7.0); confidence intervals excluding 100% considered statistically significant.
In the inhibition phase, the GMR values for AUC0–24, AUC0–∞, and Cmax of both SS- and RR-OHBUP were modest but significantly lower (by 11%–26%) compared with BUP alone, without difference in their elimination half-lives. In contrast, the GMR values for SS-THBUP exposure (AUC0–24, AUC0–∞, and Cmax) after a single dose of efavirenz was modest but significantly higher (by 18%–19%), whereas the t1/2 was prolonged (by 35%), compared with control phase (Fig. 3 and Table 2). The pharmacokinetic parameters of S- and R-BUP, SR- and RS-EHBUP, and RR-THBUP in the inhibition phase were not significantly affected compared with the control phase, except for a slight effect on t1/2 of RR-THBUP. In the induction phase, the 90% CI of the GMR values for AUC0-24 and Cmax of SS- and RR-OHBUP was outside the no-effect boundaries and significantly increased (by 24%–61%) and the terminal elimination half-lives shortened (by 17%–25%) compared with the control phase; AUC0–∞ values were within the no effect range (Fig. 3; Table 2). In contrast, GMR values for AUC0–24, AUC0–∞, and Cmax of S- and R-BUP, SR- and RS-EHBUP, and RR- and SS-THBUP in the induction phase were significantly decreased (by 43%–66%, 24%–49%, and 17%–58%, respectively) compared with the control phase. The half-lives of SR-EHBUP, RS-EHBUP, and RR-THBUP were significantly shortened in the induction phase, except that of SS-THBUP, which was significantly prolonged (by 33%) compared with the control phase; the half-lives of R-and S-BUP were within the no-effect boundaries (Fig. 3; Table 2).
Effect of Efavirenz and CYP2B6 Genotypes on the Disposition of Racemic BUP and Its Metabolites
Concentration-time profiles of OHBUP for in the control, inhibition, and induction phase (n = 53 total; 20 normal, 27 intermediate, and 6 poor metabolizers) are shown in Fig. 4. The corresponding pharmacokinetic parameters (geometric mean and 95% CI) in the control, inhibition, and induction phases as well as the GMR in percent with 90% CI for the inhibition phase (inhibition/control) and induction phase (induction/control) are listed in Table 3.
Fig. 4.
CYP2B6 genotype–dependent geometric mean concentration-time profiles of racemic hydroxybupropion (OHBUP) following a single oral dose of bupropion (100 mg) given alone (Control), 1 hour after a single oral efavirenz (600 mg) dose (Inhibition), or following 17-day treatment with efavirenz (Induction) (n = 53 total) in extensive (CYP2B6*1/*1, n = 20), intermediate (CYP2B6*1/6, n = 27), and poor (CYP2B6*6/*6, n = 6) metabolizers. Upper, concentrations up to 120 hours postdosing; below, concentrations up to 24 hours postdosing. Symbols and error bars denote geometric means and the limits of the 95% confidence interval, respectively.
TABLE 3.
Pharmacokinetic parameters of racemic bupropion and its metabolites
| Geometric Mean [90% CI] | Geometric Mean Ratio % [90% CI] | |||||
|---|---|---|---|---|---|---|
| Control Phase | Inhibition Phase | Induction Phase | Inhibition/Control | Induction/Control | ||
| Bupropion | ||||||
| AUC0–24 (nM*h) | NM | 3350 [2690–4170] | 2910 [2380–3570] | 1100 [824–1480] | 87 [78.3–96.7] | 33 [29.7–36.6] |
| IM | 3410 [2850–4080] | 3480 [2960–4090] | 1680 [1390–2020] | 102 [90.9–114] | 49.1 [43.8–55.1] | |
| PM | 3480 [2550–4770] | 4210 [2570–6900] | 2910 [1740–4860] | 121 [93.6–156] | 83.5 [64.6–108] | |
| AUC0–∞ (nM*h) | NM | 3990 [3140–5060] | 3730 [2730–5090] | 1450 [877–2390] | 93.5 [76.2–115] | 36.3 [29.6–44.5] |
| IM | 4240 [3520–5100] | 4230 [3600–4970] | 1940 [1620–2330] | 99.7 [88.7–112] | 45.9 [40.8–51.5] | |
| PM | 4340 [3400–5540] | 5230 [3450–7940] | 3420 [2070–5670] | 121 [91.3–159] | 78.9 [59.8–104] | |
| Cmax (nM) | NM | 912 [735–1130] | 763 [599–971] | 358 [250–513] | 83.6 [69.7–100] | 39.2 [32.7–47] |
| IM | 916 [740–1130] | 919 [737–1150] | 500 [383–652] | 100 [83.8–120] | 54.6 [45.6–65.3] | |
| PM | 833 [603–1150] | 1260 [627–2540] | 924 [422–2030] | 151 [93.6–245] | 111 [68.6–179] | |
| t1/2 (h) | NM | 13.5 [10.4–17.5] | 16.7 [10.8–25.7] | 16.2 [9.12–28.8] | 124 [93.7–163] | 120 [91.1–159] |
| IM | 15.4 [13–18.3] | 14.5 [11.6–18.1] | 14.7 [11.6–18.8] | 94 [80.8–109] | 95.5 [82.1–111] | |
| PM | 16.2 [10.8–24.2] | 16.4 [7.61–35.2] | 14.7 [6.25–34.8] | 101 [58.1–176] | 91 [52.3–158] | |
| Hydroxybupropion | ||||||
| AUC0–24 (nM*h) | NM | 31,300 [23,200–42,300] | 26,400 [19,400–36,000] | 38,400 [28,200–52,400] | 84.3 [75.9–93.6] | 123 [110–136] |
| IM | 22,600 [18,600–27,400] | 17,700 [14,600–21,600] | 31,500 [25,400–39,100] | 78.7 [71.3–86.8] | 140 [127–154] | |
| PM | 22,000 [10,600–45,800] | 17,400 [7440–40,900] | 17,900 [4560–70,500] | 79.3 [50.7–124] | 81.4 [52.1–127] | |
| AUC0–∞ (nM*h) | NM | 51,600 [38,100–69,800] | 48,500 [35,400–66,500] | 51,900 [37,100–72,600] | 94.1 [84–105] | 101 [89.8–113] |
| IM | 45,800 [37,300–56,200] | 39,100 [32,000–47,700] | 46,800 [37,500–58,300] | 85.4 [76.6–95.1] | 102 [91.7–114] | |
| PM | 43,700 [21,100–90,900] | 39,800 [15,500–102,000] | 30,200 [6410–142,000] | 90.9 [54.2–153] | 69.1 [41.2–116] | |
| Cmax (nM) | NM | 2140 [1600–2850] | 1690 [1250–2280] | 3190 [2440–4180] | 79 [70.6–88.4] | 149 [133–167] |
| IM | 1500 [1250–1800] | 1080 [900–1290] | 2410 [1960–2960] | 71.6 [64.9–79] | 160 [145–177] | |
| PM | 1430 [753–2700] | 1070 [497–2290] | 1260 [362–4380] | 74.8 [47.6–118] | 88.2 [56.1–139] | |
| t1/2 (h) | NM | 15.7 [14–17.7] | 18.8 [15.6–22.6] | 13.2 [9.77–17.9] | 120 [98.3–145] | 83.9 [69–102] |
| IM | 21 [19.2–23] | 19.6 [17.8–21.5] | 14.9 [13.6–16.4] | 92.9 [84.1–103] | 70.9 [64.2–78.3] | |
| PM | 20.6 [15.8–26.9] | 18.8 [13.7–26] | 18.6 [12.9–26.7] | 91.2 [71.6–116] | 90 [70.7–114] | |
| Erythrohydrobupropion | ||||||
| AUC0–24 (nM*h) | NM | 1500 [1230–1840] | 1420 [1140–1770] | 803 [612–1050] | 94.6 [84.3–106] | 53.5 [47.6–60.1] |
| IM | 1590 [1350–1870] | 1540 [1300–1840] | 1050 [866–1270] | 97 [90.6–104] | 65.9 [61.6–70.6] | |
| PM | 1870 [1250–2800] | 1930 [1240–2990] | 1660 [993–2780] | 103 [89.7–118] | 88.8 [77.3–102] | |
| AUC0–∞ (nM*h) | NM | 2700 [2190–3340] | 2710 [2130–3440] | 1320 [959–1800] | 100 [85.1–118] | 48.7 [41.3–57.3] |
| IM | 3560 [2890–4390] | 3490 [2830–4310] | 1830 [1490–2250] | 98 [90.2–106] | 51.3 [47.3–55.8] | |
| PM | 4010 [2370–6780] | 4410 [2590–7530] | 2860 [1600–5120] | 110 [92.7–131] | 71.5 [60.2–84.9] | |
| Cmax (nM) | NM | 105 [85.2–130] | 100 [79.9–126] | 68.6 [50.9–92.6] | 95.1 [83.7–108] | 65.1 [57.2–74] |
| IM | 105 [90.3–121] | 104 [87.7–123] | 78.9 [64.6–96.5] | 99.2 [89.9–109] | 75.4 [68.4–83.2] | |
| PM | 120 [79.1–182] | 132 [76.8–229] | 116 [65.7–204] | 110 [87.8–139] | 96.5 [76.8–121] | |
| t1/2 (h) | NM | 19.2 [16.9–21.9] | 18.8 [16.3–21.7] | 14.6 [11.2–18.9] | 97.9 [82.3–116] | 75.8 [63.7–90.1] |
| IM | 25.2 [22.6–28.2] | 23.2 [20.7–26] | 17.4 [15.8–19.1] | 91.8 [82.6–102] | 68.8 [62–76.5] | |
| PM | 22.5 [15.5–32.7] | 20.4 [15.2–27.4] | 17.3 [13.4–22.4] | 90.6 [69.9–118] | 77.1 [59.4–100] | |
| Threohydrobupropion | ||||||
| AUC0–24 (nM*h) | NM | 7850 [6180–9980] | 7860 [6180–10,000] | 4360 [3280–5800] | 100 [91.1–110] | 55.6 [50.5–61.1] |
| IM | 8050 [6620–9810] | 8360 [6910–10,100] | 5320 [4280–6610] | 104 [96.5–112] | 66 [61.4–71] | |
| PM | 8730 [5750–13,200] | 10,100 [5880–17,300] | 7970 [4860–13,100] | 115 [96.1–139] | 91.3 [76–110] | |
| AUC0–∞ (nM*h) | NM | 16,500 [13,300–20,500] | 17,000 [13,300–21,800] | 7640 [5770–10,100] | 103 [90–118] | 46.2 [40.4–52.8] |
| IM | 22,000 [17,300–28,100] | 21,700 [17,800–26,500] | 10,900 [8760–13,600] | 98.5 [89.3–109] | 49.5 [44.9–54.6] | |
| PM | 24,000 [13,800–41,800] | 24,300 [13,100–45,200] | 16,400 [9130–29,400] | 101 [80.9–127] | 68.3 [54.4–85.6] | |
| Cmax (nM) | NM | 657 [511–845] | 708 [554–905] | 481 [347–667] | 108 [93.7–124] | 73.2 [63.7–84.2] |
| IM | 668 [551–809] | 767 [648–908] | 537 [435–665] | 115 [103–129] | 80.5 [71.9–90.2] | |
| PM | 700 [443–1110] | 851 [482–1500] | 755 [424–1340] | 122 [92.6–160] | 108 [82.1–142] | |
| t1/2 (h) | NM | 27.3 [22.8–32.6] | 30.6 [25.6–36.4] | 23.1 [19.2–27.8] | 112 [94.8–133] | 84.7 [71.6–100] |
| IM | 41.1 [35.8–47.2] | 35.2 [30.9–40.1] | 31.2 [27.4–35.6] | 85.5 [75–97.6] | 75.8 [66.5–86.5] | |
| PM | 41.1 [25.6–66] | 31.7 [17.8–56.6] | 26.9 [12.5–57.9] | 77.2 [47.9–124] | 65.4 [40.6–105] | |
AUC, Cmax, Tmax, and t1/2 determined via noncompartmental analysis of untransformed data. Ratios and corresponding confidence intervals calculated using Phoenix WinNonlin (v7.0); confidence intervals excluding 100% considered statistically significant.
CYP2B6 genotypes were associated with OHBUP exposure in a gene-dose effect manner: highest in NM and lowest in PM irrespective of the treatment phase (Fig. 4; Table 3). The plasma exposure of OHBUP was significantly lower in PM than in NM and IM metabolizers (Fig. 4; Table 3). In the induction phase, the exposure of BUP, EHBUP, and THBUP was significantly higher in PM than NM of CYP2B6 (Table 3).
In the inhibition phase, GMR values for OHBUP Cmax and AUC0–24 were significantly lower (by 16.7%–28.4%) in NM and IM metabolizers of CYP2B6 but not in PM (Fig. 4; Table 3). The 90% CI of GMR values for the other pharmacokinetic parameters of OHBUP as well as those of BUP, EHBUP, and THBUP were within the no effect boundaries except for AUC0–24 of BUP in NM, AUC0–∞ of OHBUP in IM metabolizer, and t1/2 of THBUP, which were outside the boundaries (Table 3). In the induction phase, GMR values for Cmax and AUC0–24 of OHBUP were significantly increased (by 40%–60% and 20%–40%, respectively) in NM and IM of CYP2B6 only; t1/2 was shortened in intermediate metabolizer of CYP2B6 (Fig. 4; Table 3). The 90% CI of the GMR values in the induction phase compared with the control phase were outside the no effect range (significantly lower GMR values) for Cmax, AUC0–24, and AUC0–∞ of BUP in NM and IM (by 45.4%–77%); Cmax and AUC0–24 of EHBUP (by 24.6%–51.3%) and THBUP (by 19.5%–53.8%) in NM and IM; AUC0–∞ of EHBUP and THBUP (by a range of 28.5%–53.8%) in NM, IM, and PM; and t1/2 of EHBUP (NM, IM, and PM) and THBUP (NM and IM) (Fig. 4; Table 3).
Plasma metabolic ratios (OHBUP/BUP) versus time profiles (0–120 hours, upper panel; 0–24 hours, lower panel) are illustrated in Supplemental Fig. 2. Substantially higher MRs during the induction phase were observed in NM and IM of CYP2B6 compared with the control and inhibition phase, whereas the metabolic ratios during the inhibition phase overlapped with that of the control phase. The metabolic ratios in PM of CYP2B6 were substantially lower than in normal and intermediate metabolizers. The ratios overlapped among treatment phases (control, inhibition, and induction) in PM (Supplemental Fig. 2)
Effect of Efavirenz Stratified by CYP2B6 Genotypes on the Stereoselective Disposition of BUP and Its Metabolites
The effect of efavirenz and CYP2B6 genotypes on the pharmacokinetic parameters of stereoisomers of BUP and its metabolites following control, inhibition, and induction phases (n = 53 total; 20 normal, NM; 27 intermediate, IM; and 6 poor metabolizers, PM, of CYP2B6) was determined. CYP2B6 genotype–dependent geometric mean concentration-time profiles of RR- and SS-OHBUP is presented as a representative plot in Fig. 5. The pharmacokinetic parameters (geometric mean and 95% CI) in the control, inhibition, and induction phases as well as the GMR in percent with 90% CI for the inhibition phase (inhibition/control) and induction phase (induction/control) were determined for each genotype group (Table 4).
Fig. 5.
CYP2B6 genotype–dependent geometric mean concentration-time profiles of RR- and SS-hydroxyBUP (OHBUP) following a single oral dose of bupropion (100 mg) given alone (Control), 1 hour after a single oral efavirenz (600 mg) dose (Inhibition), or following 17-day treatment with efavirenz (Induction) (n = 52 total) in extensive (CYP2B6*1/*1, n = 20), intermediate (CYP2B6*1/6, n = 27), and poor (CYP2B6*6/*6, n = 6) metabolizers. Inset, represent concentrations up to 24-hour postdosing. Upper panel, RR-OHBUP; lower panel, SS-OHBUP. Symbols and error bars denote geometric means and the limits of the 95% confidence interval, respectively.
TABLE 4.
Genotype-dependent pharmacokinetic drug-drug interaction outcomes
| Geometric Mean [90% CI] | Geometric Mean Ratio % [90% CI] | |||||
|---|---|---|---|---|---|---|
| Control Phase | Inhibition Phase | Induction Phase | Inhibition/Control | Induction/Control | ||
| (R)-bupropion | ||||||
| AUC0–24 (nM*h) | NM | 2690 [2170–3340] | 2280 [1860–2790] | 885 [661–1190] | 84.6 [75.9–94.4] | 32.9 [29.5–36.7] |
| IM | 2770 [2310–3320] | 2720 [2310–3200] | 1320 [1090–1590] | 98.2 [87.2–110] | 47.5 [42.2–53.5] | |
| PM | 2860 [2080–3920] | 3420 [2060–5690] | 2330 [1380–3920] | 120 [91.4–157] | 81.4 [62.2–107] | |
| AUC0–∞ (nM*h) | NM | 3170 [2530–3960] | 2830 [2170–3680] | 1120 [722–1750] | 89.2 [74.2–107] | 35.5 [29.5–42.7] |
| IM | 3470 [2910–4140] | 3340 [2850–3930] | 1540 [1290–1840] | 96.3 [85.6–108] | 44.3 [39.3–49.8] | |
| PM | 3480 [2690–4500] | 4080 [2700–6160] | 2790 [1680–4620] | 117 [90.3–152] | 80 [61.7–104] | |
| Cmax (nM) | NM | 721 [584–889] | 585 [459–745] | 283 [195–409] | 81.1 [67.2–98] | 39.2 [32.5–47.4] |
| IM | 738 [593–919] | 693 [549–873] | 385 [293–505] | 93.9 [78.6–112] | 52.1 [43.6–62.3] | |
| PM | 693 [512–939] | 1020 [492–2130] | 738 [334–1630] | 148 [89.6–244] | 106 [64.5–175] | |
| t1/2 (h) | NM | 13.3 [10.5–17] | 16.1 [10.8–23.9] | 14.4 [8.39–24.7] | 120 [91.6–158] | 108 [82.1–142] |
| IM | 16.1 [13.8–18.7] | 16.7 [14.4–19.3] | 14.5 [11.6–18] | 104 [91.3–118] | 90 [79.2–102] | |
| PM | 15.2 [9.64–24] | 14.8 [6.04–36] | 15.8 [9.11–27.4] | 97 [61.7–152] | 104 [66.1–163] | |
| (S)-bupropion | ||||||
| AUC0–24 (nM*h) | NM | 613 [453–831] | 580 [437–769] | 202 [144–284] | 94.5 [83.6–107] | 33 [29.2–37.3] |
| IM | 618 [506–755] | 730 [602–886] | 349 [281–434] | 118 [105–133] | 56.5 [50–63.7] | |
| PM | 611 [418–893] | 794 [498–1270] | 568 [338–953] | 130 [102–165] | 93 [73.2–118] | |
| AUC0–∞ (nM*h) | NM | 762 [523–1110] | 730 [505–1050] | 279 [146–532] | 95.7 [74.1–124] | 36.6 [28.3–47.3] |
| IM | 795 [649–973] | 935 [766–1140] | 419 [333–527] | 118 [104–134] | 52.7 [46.4–59.8] | |
| PM | 802 [558–1150] | 1030 [705–1490] | 678 [412–1120] | 128 [96.2–170] | 84.6 [63.6–113] | |
| Cmax (nM) | NM | 186 [137–252] | 162 [115–229] | 71.4 [49.7–103] | 87.3 [72.2–105] | 38.5 [31.8–46.5] |
| IM | 176 [140–221] | 215 [169–274] | 111 [83.7–147] | 122 [99.9–150] | 63.2 [51.7–77.4] | |
| PM | 141 [88.6–224] | 230 [126–418] | 184 [87.4–387] | 163 [104–255] | 131 [83.5–204] | |
| t1/2 (h) | NM | 10.8 [6.89–17.1] | 12.5 [7.94–19.8] | 11 [5.15–23.7] | 116 [86.7–154] | 102 [76.3–136] |
| IM | 16.2 [13.1–20.2] | 17.1 [13.5–21.7] | 15.7 [11–22.4] | 105 [81.7–136] | 96.9 [75.2–125] | |
| PM | 17.2 [8.09–36.4] | 14.4 [6.85–30.3] | 15.9 [7.64–33.2] | 83.9 [44.5–158] | 92.8 [49.2–175] | |
| (RR)-hydroxybupropion | ||||||
| AUC0–24 (nM*h) | NM | 23,200 [20,000–26,900] | 19,500 [16,400–23,300] | 28,500 [24,400–33,200] | 84.2 [75.8–93.5] | 123 [111–136] |
| IM | 16,800 [14,700–19,100] | 13,200 [11,500–15,000] | 23,500 [21,000–26,300] | 78.5 [71.2–86.6] | 141 [127–155] | |
| PM | 13,300 [9620–18,400] | 10,500 [6900–15,900] | 10,700 [3920–29,100] | 78.7 [50.4–123] | 80.2 [51.3–125] | |
| AUC0–∞ (nM*h) | NM | 38,500 [33,200–44,700] | 36,100 [30,000–43,500] | 38,400 [31,800–46,300] | 93.8 [83.7–105] | 99.7 [88.9–112] |
| IM | 34,400 [29,500–40,200] | 29,400 [25,400–34,100] | 35,200 [31,100–39,800] | 85.4 [76.6–95.3] | 102 [91.7–114] | |
| PM | 26,600 [18,100–39,100] | 24,600 [14,600–41,500] | 18,100 [5450–60,300] | 92.5 [55–155] | 68.1 [40.5–114] | |
| Cmax (nM) | NM | 1580 [1380–1810] | 1240 [1040–1480] | 2340 [2090–2620] | 78.8 [70.4–88.1] | 148 [132–166] |
| IM | 1110 [974–1260] | 794 [695–906] | 1790 [1590–2000] | 71.5 [64.9–78.9] | 161 [146–178] | |
| PM | 858 [632–1170] | 640 [444–923] | 748 [305–1830] | 74.6 [47.5–117] | 87.1 [55.5–137] | |
| t1/2 (h) | NM | 15.9 [14.1–17.8] | 18.2 [15.6–21.2] | 12.5 [9.78–15.9] | 115 [97.1–136] | 78.6 [66.5–93] |
| IM | 21.3 [19.4–23.4] | 20.2 [18.3–22.3] | 15 [13.6–16.5] | 94.9 [85.7–105] | 70.3 [63.5–77.7] | |
| PM | 20.8 [15.9–27.3] | 20.3 [15.9–25.9] | 18.6 [13–26.6] | 97.6 [75.2–127] | 89.5 [69–116] | |
| (SS)-hydroxybupropion | ||||||
| AUC0–24 (nM*h) | NM | 1480 [1270–1730] | 1270 [1050–1540] | 1800 [1520–2140] | 85.8 [76.4–96.3] | 121 [108–136] |
| IM | 1130 [932–1360] | 914 [751–1110] | 1470 [1250–1730] | 81.2 [72.1–91.4] | 131 [116–147] | |
| PM | 763 [524–1110] | 733 [442–1210] | 804 [284–2280] | 96.1 [58.5–158] | 105 [64.1–173] | |
| AUC0–∞ (nM*h) | NM | 2100 [1810–2420] | 1890 [1540–2320] | 2160 [1790–2610] | 90.3 [80.7–101] | 103 [92.2–115] |
| IM | 1830 [1510–2220] | 1550 [1260–1910] | 1880 [1600–2210] | 84.7 [74.7–96] | 103 [90.6–116] | |
| PM | 1280 [830–1980] | 1350 [812–2250] | 1180 [393–3530] | 106 [60.9–183] | 91.9 [53.1–159] | |
| Cmax (nM) | NM | 129 [112–148] | 108 [85.6–136] | 214 [178–257] | 83.6 [72.5–96.3] | 166 [144–191] |
| IM | 90.4 [73.3–111] | 67.9 [54.8–84.2] | 150 [126–179] | 75.1 [65.4–86.3] | 166 [145–191] | |
| PM | 60.2 [40.9–88.5] | 55.3 [30.8–99.1] | 76.8 [22.6–261] | 91.9 [51.1–165] | 128 [71–230] | |
| t1/2 (h) | NM | 13 [11.1–15.2] | 13.9 [11.4–16.8] | 12.3 [8.41–18.1] | 106 [81.6–139] | 94.9 [72.7–124] |
| IM | 16.4 [14.9–17.9] | 17.6 [15.5–20] | 12.5 [10.7–14.6] | 108 [94.7–123] | 76.3 [67–86.8] | |
| PM | 18.4 [14.1–23.9] | 20.4 [14.9–28] | 14.5 [10.5–20] | 111 [82.3–150] | 78.9 [58.4–107] | |
| (SR)-erythrohydrobupropion | ||||||
| AUC0–24 (nM*h) | NM | 844 [647–1100] | 778 [594–1020] | 428 [315–582] | 92.2 [81.8–104] | 50.8 [45–57.2] |
| IM | 870 [660–1150] | 836 [635–1100] | 574 [424–778] | 96.1 [89.9–103] | 66 [61.7–70.5] | |
| PM | 1290 [746–2230] | 1320 [691–2540] | 1090 [547–2190] | 103 [85.5–124] | 84.9 [70.6–102] | |
| AUC0–∞ (nM*h) | NM | 1470 [1010–2140] | 1420 [972–2060] | 654 [442–967] | 96.4 [83.4–111] | 44.5 [38.5–51.4] |
| IM | 1840 [1220–2770] | 1760 [1170–2640] | 955 [648–1410] | 95.7 [88.6–103] | 52 [48.2–56.1] | |
| PM | 2770 [1360–5650] | 3000 [1400–6430] | 1880 [838–4220] | 109 [90.4–130] | 67.9 [56.5–81.5] | |
| Cmax (nM) | NM | 65.5 [54.1–79.2] | 60.4 [48.8–74.7] | 39.6 [30.4–51.5] | 92.2 [81–105] | 60.5 [53.1–68.9] |
| IM | 64.7 [56.6–73.9] | 61 [52–71.4] | 46.3 [37.3–57.4] | 94.3 [84–106] | 71.5 [63.8–80.3] | |
| PM | 85.9 [55.1–134] | 85.1 [47.7–152] | 74.6 [42.2–132] | 99.1 [80–123] | 86.8 [70.1–108] | |
| t1/2 (h) | NM | 16.7 [13–21.5] | 17.5 [14.3–21.5] | 15.2 [11.4–20.3] | 105 [83.5–132] | 91 [72.4–114] |
| IM | 22.4 [18.7–26.9] | 20.8 [17.7–24.4] | 17.4 [15.1–20.2] | 92.9 [80.4–107] | 77.8 [67.3–89.9] | |
| PM | 22.5 [16.4–30.9] | 19.5 [14.7–26] | 15.5 [12–20.1] | 86.9 [63.5–119] | 69 [50.4–94.4] | |
| (RS)-erythrohydrobupropion | ||||||
| AUC0–24 (nM*h) | NM | 487 [328–723] | 489 [329–727] | 292 [191–446] | 100 [91.5–110] | 59.9 [54.6–65.8] |
| IM | 505 [380–673] | 525 [403–686] | 341 [258–450] | 104 [95.9–113] | 67.5 [62.2–73.1] | |
| PM | 435 [221–858] | 523 [266–1030] | 423 [199–897] | 120 [99–146] | 97 [79.9–118] | |
| AUC0–∞ (nM*h) | NM | 733 [459–1170] | 894 [521–1540] | 417 [252–689] | 122 [105–142] | 56.9 [49–66.1] |
| IM | 877 [607–1270] | 931 [659–1310] | 493 [350–694] | 106 [96.2–117] | 56.3 [51–62.1] | |
| PM | 762 [291–2000] | 861 [311–2380] | 614 [240–1570] | 113 [89.8–142] | 80.6 [64.1–101] | |
| Cmax (nM) | EM | 43 [30.4–60.8] | 42.9 [30.6–60.2] | 28.8 [19.9–41.7] | 99.8 [87.7–114] | 67 [58.9–76.3] |
| IM | 42.4 [32.9–54.6] | 42.7 [32.9–55.4] | 31.9 [24.7–41.2] | 101 [90.6–112] | 75.2 [67.7–83.6] | |
| PM | 35.1 [18.2–67.6] | 47.3 [21.3–105] | 40.2 [17.4–92.6] | 135 [95–191] | 114 [80.6–162] | |
| t1/2 (h) | NM | 14.1 [11.7–16.9] | 17.9 [10.7–29.8] | 12.1 [9.46–15.5] | 127 [98.3–165] | 86.2 [66.6–111] |
| IM | 17.3 [14.3–20.8] | 16.4 [14.2–19] | 13.2 [10.9–16] | 95.1 [83.6–108] | 76.8 [67.5–87.3] | |
| PM | 18.5 [11.1–30.7] | 14.2 [7.82–25.8] | 14 [10.2–19] | 76.8 [61.2–96.3] | 75.5 [60.2–94.8] | |
| (RR)-threohydrobupropion | ||||||
| AUC0–24 (nM*h) | NM | 4240 [3450–5210] | 3890 [3230–4680] | 2160 [1710–2740] | 91.7 [83.7–100] | 51 [46.5–55.9] |
| IM | 4340 [3680–5110] | 4050 [3420–4800] | 2710 [2280–3220] | 93.4 [86.6–101] | 62.5 [58–67.4] | |
| PM | 4570 [3140–6650] | 4840 [2630–8910] | 4030 [2580–6290] | 106 [88.7–126] | 88.1 [73.9–105] | |
| AUC0–∞ (nM*h) | NM | 12,800 [10,300–15,900] | 12,300 [9980–15,200] | 5040 [3910–6500] | 97.5 [83.8–113] | 39.5 [34–45.8] |
| IM | 18,900 [14,800–24,200] | 16,300 [13,600–19,600] | 7840 [6480–9500] | 86.4 [76.7–97.2] | 41.4 [36.8–46.7] | |
| PM | 20,600 [10,300–41,100] | 22,200 [10,500–46,900] | 12,200 [6540–22,700] | 108 [76.6–152] | 59.1 [42–83.2] | |
| Cmax (nM) | NM | 245 [197–304] | 227 [188–275] | 147 [113–191] | 92.6 [83.3–103] | 59.9 [53.9–66.6] |
| IM | 237 [201–279] | 230 [196–270] | 168 [139–203] | 97.2 [89–106] | 70.9 [64.9–77.4] | |
| PM | 259 [158–425] | 271 [150–490] | 226 [134–380] | 105 [89.3–123] | 87.3 [74.3–102] | |
| t1/2 (h) | NM | 36.1 [31.4–41.4] | 35.7 [31.2–40.7] | 26.1 [22.8–29.9] | 99 [85.3–115] | 72.4 [62.5–83.9] |
| IM | 56.1 [47.8–65.9] | 40.5 [34.7–47.3] | 34.9 [31.2–38.9] | 72.2 [62.1–84.1] | 62.1 [53.4–72.3] | |
| PM | 57.1 [35.1–92.8] | 46.6 [30.4–71.2] | 40 [22.2–72.1] | 81.5 [48.1–138] | 70 [41.3–119] | |
| (SS)-threohydrobupropion | ||||||
| AUC0–24 (nM*h) | NM | 3270 [2310–4620] | 3720 [2650–5230] | 2030 [1380–3010] | 114 [99.4–130] | 62.2 [54.3–71.3] |
| IM | 3460 [2630–4540] | 4070 [3180–5210] | 2470 [1880–3260] | 118 [107–129] | 71.6 [65.3–78.4] | |
| PM | 3910 [2200–6980] | 5090 [3020–8580] | 3850 [2120–6970] | 130 [101–167] | 98.3 [76.6–126] | |
| AUC0–∞ (nM*h) | NM | 3750 [2580–5460] | 4410 [2990–6500] | 2260 [1490–3430] | 118 [103–135] | 60.3 [52.6–69.1] |
| IM | 4200 [3000–5890] | 4930 [3670–6640] | 2780 [2040–3790] | 117 [106–130] | 66.2 [60–73] | |
| PM | 4700 [2520–8750] | 6230 [3530–11,000] | 4340 [2350–8010] | 133 [103–170] | 92.3 [71.9–119] | |
| Cmax (nM) | NM | 456 [342–607] | 504 [381–665] | 345 [240–494] | 111 [94.1–130] | 75.6 [64.3–88.9] |
| IM | 473 [381–588] | 569 [475–682] | 387 [308–485] | 120 [106–137] | 81.7 [71.8–92.9] | |
| PM | 483 [276–845] | 622 [348–1110] | 567 [299–1070] | 129 [89.7–185] | 117 [81.7–169] | |
| t1/2 (h) | NM | 8.97 [7.48–10.7] | 13.4 [9.69–18.5] | 12.2 [8.55–17.4] | 149 [116–192] | 136 [106–175] |
| IM | 10.4 [8.9–12.3] | 13.3 [10.8–16.5] | 14.6 [11–19.2] | 128 [105–155] | 140 [115–170] | |
| PM | 10.3 [8.24–12.8] | 12.7 [6.49–24.7] | 10.3 [6.72–15.8] | 123 [83.7–181] | 100 [68.2–148] | |
AUC, Cmax, Tmax, and t1/2 determined via noncompartmental analysis of untransformed data. Ratios and corresponding confidence intervals calculated using Phoenix WinNonlin (v7.0); confidence intervals excluding 100% considered statistically significant.
In the inhibition phase, the GMR values were slightly but significantly lower for the Cmax and AUC0–24 of RR- and SS-OHBUP (range by 14.2%–28.5%) in NM and IM of CYP2B6; AUC0–∞ of SS- and RR-OHBUP (IM); Cmax and AUC0–24 of BUP (NM); and AUC0–24 (NM), AUC0–∞, and t1/2 (both in IM) of RR-THBUP. In contrast, the GMR values were higher (range by 14%–33%) for SS-THBUP Cmax (IM), AUC0–24 (IM and PM), and AUC0–∞ (NM, IM, and PM); and t1/2 was shorter by 28%–49% (NM and IM) (Table 4). Other pharmacokinetic parameters of the analytes remained within the no-effect boundaries in the inhibition phase versus the control phase (Table 4). In the induction phase, the 90% CI of GMR values was outside the no-effect boundaries (the GMR values were significantly lower by 48%–77% and 37%–77%, respectively) for S-BUP and R-BUP Cmax, AUC0–24, and AUC0–∞ (NM and IM but not in PM of CYP2B6) (Table 4). Conversely, the GMR values for RR- and SS-OHBUP Cmax and AUC0–24 were significantly increased (by 21%–66%) in NM and IM of CYP2B6, whereas t1/2 values for RR-OHBUP (NM and IM) and SS-OHBUP (IM) was significantly shortened (Table 4). Lower GMR values were observed in the induction phase for Cmax and AUC0–24 of RS- and SR-EHBUP and RR- and SS-THBUP (NM and IM); AUC0-∞ of SR-EHBUP and RR-THBUP (all genotypes), and RS-EHBUP and SS-THBUP (NM and IM). The t1/2 of SR- and RS-EHBUP (IM and PM) and RR-THBUP (NM and IM) was shorter. In contrast, the GMR values for t1/2 of SS-THBUP was increased significantly in NM and IMs of CYP2B6.
In Supplemental Fig. 3: 1) metabolic ratios of SS-OHBUP/BUP and RR-OHBUP/BUP versus time profiles are illustrated and indicate substantially higher MRs during the induction phase in normal and intermediate metabolizers; 2) MRs during the inhibition phase overlapped with that of control phase for both SS- and RR-OHBUP; and 3) MRs were substantially lower in poor metabolizer compared with normal and intermediate metabolizers. No difference in MRs was observed among the control, inhibition, and induction phases in poor metabolizer.
The Cmax and AUC0–24 metabolic ratios (OHBUP/BUP, SS-OHBUP/S-BUP, and RR-OHBUP/R-BUP) in each genotype (normal, intermediate, and poor metabolizer) and in each treatment phases (control, inhibition, and induction phases) were determined as a measure of CYP2B6 activity (Fig. 6). Bars and error bars denote the geometric mean ratio and upper limits of the 95% confidence interval, respectively. The MRs (both Cmax and AUC0–24) were altered in gene-dose effect manner (i.e., higher in NM followed by IM and then PM of CYP2B6) consistently in all treatment phases (control, inhibition, and induction); CYP2B6 activity was not induced by efavirenz in poor metabolizers.
Fig. 6.
Genotype-dependent metabolite: parent ratios (n = 53) of AUC0–24 and Cmax in 20 normal metabolizers, 27 intermediate metabolizers, and 6 poor metabolizers of CYP2B6. AUC0–24 and Cmax ratios, respectively, for RR-hydroxyBUP (RR-OHBUP)/R-bupropion (BUP) (A and B); for SS-hydroxyBUP (SS-OHBUP)/S-bupropion (S-BUP) (C and D); and for racemic hydroxyBUP (OHBUP)/bupropion (BUP) (E and F). Bars and error bars denote the geometric mean ratio and upper limits of the 95% confidence interval, respectively.
In Supplemental Fig. 4, the ratios of R-BUP/S-BUP, RR-OHBUP/SS-OHBUP, RR-THBUP/SS-THBUP, and SR-EHBUP/RS-EHBUP ratios (0–120 hours and 0–24 hours) are presented. The effect of efavirenz on the disposition of BUP and its metabolites was nonstereospecific as shown by the overlapping ratios of each corresponding stereoisomer pair among the treatment phases [(control, inhibition, and induction phases) (Supplemental Fig. 4)]. The ratios also remained within each CYP2B6 genotype group among the treatment phases (data not shown). Although a slight difference in the disposition of SS- and RR-THBUP was observed during the inhibition phase, the effect was too small to reveal stereospecific interaction.
Discussion
Efavirenz (a substrate, inducer, and inhibitor of CYP2B6) is hypothesized to influence CYP2B6 activity, efavirenz exposure, and DDI risks with other substrates of CYP2B6 and those drugs metabolized by enzymes other than CYP2B6 via complex time- and CYP2B6 genotype–dependent mechanisms. In this study, we determined the effects of a single dose and multiple doses of efavirenz as well as CYP2B6 genotypes on the complex disposition of racemic and stereoisomers of BUP and its active metabolites.
We have shown previously that efavirenz is a strong inhibitor of CYP2B6 activity in vitro (Xu and Desta, 2013). The current findings provide the first in vivo evidence that acute administration of efavirenz inhibits CYP2B6 activity in a genotype-dependent manner as reflected by significantly lower exposure of OHBUP and its diastereomers in NM and IM of CYP2B6 but not in PM of CYP2B6. These data contrast with our previous in vitro data showing that the CYP2B6*6 allele is more susceptible to inhibition by voriconazole than CYP2B6*1/*1 (Xu et al., 2012). This discrepancy could be due to differences in the substrate (efavirenz) and inhibitor (voriconazole) used in vitro (Xu et al., 2012) compared with the in vivo substrate (BUP) and inhibitor (efavirenz) (current data). Alternatively, the in vitro data are simply poor predictors of in vivo outcomes. In contrast, the exposure of THBUP and SS-THBUP (but not that of RR-THBUP) was increased during the inhibition phase, and this effect was greater in PM and/or IM of CYP2B6. Efavirenz is a strong inhibitor of enzymes (e.g., UGT2B7 and CYP2C19) (Belanger et al., 2009; Ji et al., 2012; Xu and Desta, 2013) catalyzing further metabolism of SS-THBUP (Zhu et al., 2014; Gufford et al., 2016; Sager et al., 2016) and may inhibit the elimination of SS-THBUP in a concentration-dependent manner. Together, acute administration of efavirenz inhibits CYP2B6 and the metabolism of SS-THBUP in a CYP2B6 genotype–dependent manner. This acute inhibition is offset by a net induction during chronic dosing with efavirenz (see below), although the short-term safety of CYP2B6 substrates with narrow therapeutic range may be altered when efavirenz-based HIV therapy is added to patients stabilized on CYP2B6 substrates.
Our data show that chronic treatment with efavirenz strikingly reduced the exposure of racemic-, S-, and R-BUP, whereas the exposure of racemic OHBUP and its diastereomers as well as the respective metabolite/parent ratios were significantly increased. The chronic effect of efavirenz on racemic BUP and OHBUP confirms previous findings (Robertson et al., 2008). However, ours is the first to demonstrate substantial effect on stereoisomers of BUP and OHBUP and their metabolic ratios, providing important mechanistic insights. Chronic efavirenz activates the constitutive androstane receptor (Faucette et al., 2007; Meyer zu Schwabedissen et al., 2012) and pregnane X receptor (Sharma et al., 2013) and thereby increases the expression of several drug disposition genes, including CYP2B6 (Meyer zu Schwabedissen et al., 2012; Sharma et al., 2013). Although simultaneous acute inhibition/chronic induction of CYP2B6 may occur with chronic administration of efavirenz, the net average effect was induction. The extent of CYP2B6 induction by efavirenz exhibited extensive variability among individuals. We demonstrated for the first time that this variability is dictated by CYP2B6 genotypes. Compared with the control phase, significantly higher exposure of OHBUP, its diastereomers, and the respective metabolic ratios was observed after pretreatment with efavirenz in NM>IM, with no (or marginal) difference in PM of CYP2B6. The direction of CYP2B6 genotype–dependent interaction mirrored interplay between CYP2B6 genotypes and efavirenz autoinduction (Ngaimisi et al., 2011; Metzger et al., 2013; Desta et al., 2019; Desta et al., 2021). Other inducers such as rifampin (Li et al., 2010), carbamazepine (Zhu et al., 2009), and sodium ferulate (Gao et al., 2013) also appear to induce this enzyme in a CYP2B6 genotype–dependent manner, suggesting that this phenomenon may not be unique to efavirenz alone, and thus, the data may be generalizable to other DDIs mediated by CYP2B6 induction. Together, chronic administration of efavirenz may alter safety or efficacy of CYP2B6 substrates by enhancing bioactivation (e.g., BUP 4-hydroxylation) [present data; (Robertson et al., 2008)] or systemic clearance (e.g., methadone) (Kharasch et al., 2012) in NMs and IMs but not in PMs of CYP2B6.
The mechanism by which efavirenz causes a large decrease in the exposure of BUP and its enantiomers is unlikely due to induction of CYP2B6-mediated BUP 4-hydroxylation as the fraction metabolized by CYP2B6 under basal conditions is small (∼21%) (Sager et al., 2016). This is further supported by the lack of meaningful effect of modulators of CYP2B6 on BUP systemic clearance despite their marked effect on OHBUP exposure [present data from the inhibition phase; (Eum et al., 2022)]. Our recent data (Bamfo et al., 2022) and findings from other authors (Sager et al., 2016) support that BUP reduction, particularly to THBUP and SS-THBUP, represents the major clearance mechanism of BUP and its enantiomers in vitro. Therefore, we speculate that efavirenz’s chronic effect on the systemic elimination of BUP and its enantiomers is primarily via induction of one or more enzymes that catalyze BUP reduction, typically 11β-HSD1 and/or aldo-keto-reductase located in the liver and intestine (Meyer et al., 2013; Connarn et al., 2015; Bamfo et al., 2022). The extent of decrease in exposure of racemic-, R-, and S-BUP by efavirenz was greater for NMs and IMs compared with PMs of CYP2B6, reflecting a potential increase in the fraction metabolized via 4-hydroxylation during induction in NM and IM but not PM of CYP2B6. Induction of the reductive pathways of BUP by efavirenz have not been reported before, and this finding may reveal novel efavirenz DDI mechanisms.
Unlike the exposure of OHBUP and its diastereomers, we noted a substantial reduction in the exposure of THBUP and EHBUP and their diastereomers following chronic efavirenz. A similar observation was observed with another inducer, carbamazepine (Ketter et al., 1995). Since a substantial decrease in the clearance of BUP was shown with efavirenz and carbamazepine, inhibition of BUP-reductive pathways cannot explain the significantly reduced exposure of the reductive BUP metabolites. Instead, efavirenz likely causes induction of secondary metabolism of BUP-reductive metabolites. All BUP metabolites (OHBUP, THBUP, and EHBUP) and their stereoisomers undergo conjugation via UGTs (mainly UGT1A9 and UGT2B7) (Gufford et al., 2016). Additionally, THBUP and EHBUP undergo 4-hydroxylation via CYP2C19 (Zhu et al., 2014; Sager et al., 2016). These enzymes (UGTs and CYP2C19) are inducible by efavirenz in vivo (Cho et al., 2011; Michaud et al., 2012). Our data showing a more rapid terminal elimination of racemic and stereoisomers of OHBUP (following the early increase in maximal plasma concentrations), THBUP and EHBUP as well as the substantial reduction in exposure of BUP-reductive metabolites by chronic efavirenz, provide support for induction of secondary metabolic pathways of BUP. Of note, the elimination rate appears to be higher than the formation rate for the reductive metabolites, probably due to induction via both CYP2C19 (Zhu et al., 2014; Sager et al., 2016) and UGTs (Gufford et al., 2016), whereas the formation rate OHBUP appears to be greater than its elimination, indicating a greater rate of induction of CYP2B6 than the rate of elimination via UGTs (Gufford et al., 2016).
Our data from both the inhibition and induction phases provide no evidence that the effects of efavirenz and CYP2B6 on the disposition of BUP and its metabolites is stereospecific (Supplemental Fig. 4). Stereoselective induction of OHBUP by rifampin was suggested previously (Xu et al., 2007; Kharasch et al., 2008). Although there appears to be a crosstalk, the relative activation of CAR and PXR by efavirenz and rifampin in the liver and gut appear to differ (Faucette et al., 2006; Meyer zu Schwabedissen et al., 2012). Thus, it is possible that efavirenz and rifampin differ in their ability to induce the complex primary and/or secondary elimination pathways or other BUP disposition pathways.
In summary, efavirenz exhibits complex, time- and CYP2B6 genotype–dependent interactions with BUP disposition. Acute and chronic administration of efavirenz inhibits and induces CYP2B6 activity, respectively, and the extent of these effects were CYP2B6 genotype–dependent. Chronic efavirenz increases the rate of elimination of 1) BUP and its enantiomers, predominantly via induction of BUP reductive pathways, and 2) all BUP metabolites and their diastereomers via induction of sequential metabolic pathways. The effects of efavirenz and CYP2B6 genotypes on the disposition of BUP and its metabolites were nonstereoselective. Overall, these findings provide important mechanistic and clinical insights. First, these data reveal additional new mechanisms underlying efavirenz DDIs with BUP. Second, 4-hydroxylation of racemic BUP and its enantiomers represents an acceptable, though complex, in vivo probe for ascertaining the effect of genetic and nongenetic factors dictating CYP2B6 activity at basal and induced conditions. Third, altered metabolic patterns may have implications for the safe and optimal use of BUP when prescribed with inducers, given that BUP’s in vivo effects, toxicity, and DDI with CYP2D6 are mediated by BUP and its active metabolites (Silverstone et al., 2008; Sager et al., 2017; Dash et al., 2018; Costa et al., 2019). Lastly, the complex DDI mechanisms observed in this study highlight important study design considerations when characterizing future additional efavirenz DDIs.
Abbreviations
- 11β-HSD1
11β-hydroxysteroid dehydrogenase 1
- AUC0-24, AUC0–∞
area under the plasma concentration time curve (AUC) from zero to 24 hour (AUC0-24) and from zero to infinity (AUC0–∞)
- BUP
bupropion
- CI
confidence interval
- Clast
last measured concentration
- CNS
central nervous system
- DDI
drug-drug interaction
- EHBUP
erythrohydrobupropion
- GMR
geometric mean ratios
- CRC
Clinical Research Center
- IM
intermediate metabolizer of CYP2B6
- LC-MS/MS
liquid chromatography–tandem mass spectrometry
- NM
normal metabolizer of CYP2B6
- OHBUP
4-hydroxybupropion
- PM
poor metabolizer of CYP2B6
- R-BUP
R-bupropion
- RR-OHBUP
(2R,3R)-4-hydroxybupropion
- RR-THBUP
(2R,3R)-threohydrobupropion
- RS-EHBUP
(2R,3S)-erythrohydrobupropion
- S-BUP
S-bupropion
- SR-EHBUP
(2S,3R)-erythrohydrobbupropion
- SS-OHBUP
(2S,3S)-4-hydroxybupropion
- SS-THBUP
(2S,3S)-threohydrobupropion
- t1/2
half-life
- THBUP
threohydrobupropion
- tmax
time to maximal plasma concentration (Cmax)
- λ z
terminal elimination rate constant
Authorship Contributions
Participated in research design: Gufford, Desta.
Conducted experiments: Metzger, Benson, Masters, Lu.
Contributed new reagents or analytical tools: Masters.
Performed data analysis: Metzger, Bamfo, Gufford, Desta.
Wrote or contributed to the writing of the manuscript: Gufford, Metzger, Bamfo, Masters, Lu, Desta.
Footnotes
This work was supported by National Institutes of Health National Institute of General Medical Sciences [Grant R01-GM078501], [Grant R01-GM121707], and [Grant R35-GM145383] (to Z.D.). B.T.G and N.O.B fellowship was supported by the Grant T32-GM008425 (to Z.D.). Bioanalyses were performed, in part, by the Clinical Pharmacology Analytical Core laboratory, a core laboratory of the Indiana University Melvin and Bren Simon Cancer Center supported by National Institutes of Health National Cancer Institute [Grant P30-CA082709].
No author has an actual or perceived conflict of interest with the contents of this article.
Current affiliation: Department of Pharmacy, Faculty of Health Sciences, Universidade de Brasília, Brasília, Brazil.
This article has supplemental material available at jpet.aspetjournals.org.
References
- Bamfo NO, Lu JBL, Desta Z (2022) Stereoselective metabolism of bupropion to active metabolites in cellular fractions of human liver and intestine. Drug Metab Dispos DOI: 10.1124/dmd.122.000867 [published ahead of print]. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bélanger AS, Caron P, Harvey M, Zimmerman PA, Mehlotra RK, Guillemette C (2009) Glucuronidation of the antiretroviral drug efavirenz by UGT2B7 and an in vitro investigation of drug-drug interaction with zidovudine. Drug Metab Dispos 37:1793–1796. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Benowitz NL, Zhu AZ, Tyndale RF, Dempsey D, Jacob P 3rd (2013) Influence of CYP2B6 genetic variants on plasma and urine concentrations of bupropion and metabolites at steady state. Pharmacogenet Genomics 23:135–141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Burgess KS, Ipe J, Swart M, Metzger IF, Lu J, Gufford BT, Thong N, Desta Z, Gaedigk R, Pearce RE, et al. (2017) Variants in the CYP2B6 3'UTR Alter In Vitro and In Vivo CYP2B6 Activity: Potential Role of MicroRNAs. Clin Pharmacol Ther 104:130–138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cho D-YSJ, Shen JH, Lemler SM, Skaar TC, Li L, Blievernicht J, Zanger UM, Kim KB, Shin JG, Flockhart DA, et al. (2016) Rifampin enhances cytochrome P450 (CYP) 2B6-mediated efavirenz 8-hydroxylation in healthy volunteers. Drug Metab Pharmacokinet 31:107–116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cho DY, Ogburn ET, Jones D, Desta Z (2011) Contribution of N-glucuronidation to efavirenz elimination in vivo in the basal and rifampin-induced metabolism of efavirenz. Antimicrob Agents Chemother 55:1504–1509. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Clarke SM, Mulcahy FM, Tjia J, Reynolds HE, Gibbons SE, Barry MG, Back DJ (2001) The pharmacokinetics of methadone in HIV-positive patients receiving the non-nucleoside reverse transcriptase inhibitor efavirenz. Br J Clin Pharmacol 51:213–217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Clifford DB, Evans S, Yang Y, Acosta EP, Goodkin K, Tashima K, Simpson D, Dorfman D, Ribaudo H, Gulick RM (2005) Impact of efavirenz on neuropsychological performance and symptoms in HIV-infected individuals. Ann Intern Med 143:714–721. [DOI] [PubMed] [Google Scholar]
- Cluck D, Lewis P, Durham SH, Hester EK (2016) The Rise and Fall of Efavirenz. J Int Assoc Provid AIDS Care 15:181–183. [DOI] [PubMed] [Google Scholar]
- Coles R, Kharasch ED (2008) Stereoselective metabolism of bupropion by cytochrome P4502B6 (CYP2B6) and human liver microsomes. Pharm Res 25:1405–1411. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Connarn JN, Zhang X, Babiskin A, Sun D (2015) Metabolism of bupropion by carbonyl reductases in liver and intestine. Drug Metab Dispos 43:1019–1027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Costa R, Oliveira NG, Dinis-Oliveira RJ (2019) Pharmacokinetic and pharmacodynamic of bupropion: integrative overview of relevant clinical and forensic aspects. Drug Metab Rev 51:293–313. [DOI] [PubMed] [Google Scholar]
- Dash RP, Rais R, Srinivas NR (2018) Chirality and neuropsychiatric drugs: an update on stereoselective disposition and clinical pharmacokinetics of bupropion. Xenobiotica 48:945–957. [DOI] [PubMed] [Google Scholar]
- Desta Z, El-Boraie A, Gong L, Somogyi AA, Lauschke VM, Dandara C, Klein K, Miller NA, Klein TE, Tyndale RF, et al. (2021) PharmVar GeneFocus: CYP2B6. Clin Pharmacol Ther 110:82–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Desta Z, Gammal RS, Gong L, Whirl-Carrillo M, Gaur AH, Sukasem C, Hockings J, Myers A, Swart M, Tyndale RF, et al. (2019) Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2B6 and Efavirenz-Containing Antiretroviral Therapy. Clin Pharmacol Ther 106:726–733. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Desta Z, Metzger IF, Thong N, Lu JB, Callaghan JT, Skaar TC, Flockhart DA, Galinsky RE (2016) Inhibition of Cytochrome P450 2B6 Activity by Voriconazole Profiled Using Efavirenz Disposition in Healthy Volunteers. Antimicrob Agents Chemother 60:6813–6822. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Desta Z, Saussele T, Ward B, Blievernicht J, Li L, Klein K, Flockhart DA, Zanger UM (2007) Impact of CYP2B6 polymorphism on hepatic efavirenz metabolism in vitro. Pharmacogenomics 8:547–558. [DOI] [PubMed] [Google Scholar]
- Eum S, Sayre F, Lee AM, Stingl JC, Bishop JR (2022) Association of CYP2B6 genetic polymorphisms with bupropion and hydroxybupropion exposure: A systematic review and meta-analysis. Pharmacotherapy 42:34–44. [DOI] [PubMed] [Google Scholar]
- Faucette SR, Zhang T-C, Moore R, Sueyoshi T, Omiecinski CJ, LeCluyse EL, Negishi M, Wang H(2007) Relative activation of human pregnane X receptor versus constitutive androstane receptor defines distinct classes of CYP2B6 and CYP3A4 inducers. J Pharmacol Exp Ther 320:72–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Faucette SR, Hawke RL, Lecluyse EL, Shord SS, Yan B, Laethem RM, Lindley CM (2000) Validation of bupropion hydroxylation as a selective marker of human cytochrome P450 2B6 catalytic activity. Drug Metab Dispos 28:1222–1230. [PubMed] [Google Scholar]
- Gao L, He Y, Tang J, Yin J, Huang Z, Liu F, Ouyang D, Chen X, Zhang W, Liu Z, et al. (2013) Genetic Variants of Pregnane X Receptor (PXR) and CYP2B6 Affect the Induction of Bupropion Hydroxylation by Sodium Ferulate. PLoS One 8:e62489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gufford BTLJ, Lu JB, Metzger IF, Jones DR, Desta Z (2016) Stereoselective Glucuronidation of Bupropion Metabolites In Vitro and In Vivo. Drug Metab Dispos 44:544–553. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gulick RM, Ribaudo HJ, Shikuma CM, Lustgarten S, Squires KE, Meyer WA 3rd, Acosta EP, Schackman BR, Pilcher CD, Murphy RL, et al. ; AIDS Clinical Trials Group Study A5095 Team (2004) Triple-nucleoside regimens versus efavirenz-containing regimens for the initial treatment of HIV-1 infection. N Engl J Med 350:1850–1861. [DOI] [PubMed] [Google Scholar]
- Haas DW, Cramer YS, Godfrey C, Rosenkranz SL, Aweeka F, Berzins B, Coombs R, Coughlin K, Moran LE, Gingrich D, et al. ; AIDS Clinical Trials Group A5316 Study Team (2020) Pharmacogenetic interactions between antiretroviral drugs and vaginally administered hormonal contraceptives. Pharmacogenet Genomics 30:45–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Habtewold A, Amogne W, Makonnen E, Yimer G, Nylén H, Riedel KD, Aderaye G, Bertilsson L, Burhenne J, Diczfalusy U, et al. (2013) Pharmacogenetic and pharmacokinetic aspects of CYP3A induction by efavirenz in HIV patients. Pharmacogenomics J 13:484–489. [DOI] [PubMed] [Google Scholar]
- Hesse LM, Venkatakrishnan K, Court MH, von Moltke LL, Duan SX, Shader RI, Greenblatt DJ (2000) CYP2B6 mediates the in vitro hydroxylation of bupropion: potential drug interactions with other antidepressants. Drug Metab Dispos 28:1176–1183. [PubMed] [Google Scholar]
- Holzinger ER, Grady B, Ritchie MD, Ribaudo HJ, Acosta EP, Morse GD, Gulick RM, Robbins GK, Clifford DB, Daar ES, et al. (2012) Genome-wide association study of plasma efavirenz pharmacokinetics in AIDS Clinical Trials Group protocols implicates several CYP2B6 variants. Pharmacogenet Genomics 22:858–867. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ji HY, Lee H, Lim SR, Kim JH, Lee HS (2012) Effect of efavirenz on UDP-glucuronosyltransferase 1A1, 1A4, 1A6, and 1A9 activities in human liver microsomes. Molecules 17:851–860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ketter TA, Jenkins JB, Schroeder DH, Pazzaglia PJ, Marangell LB, George MS, Callahan AM, Hinton ML, Chao J, Post RM (1995) Carbamazepine but not valproate induces bupropion metabolism. J Clin Psychopharmacol 15:327–333. [DOI] [PubMed] [Google Scholar]
- Kharasch ED, Mitchell D, Coles R (2008) Stereoselective bupropion hydroxylation as an in vivo phenotypic probe for cytochrome P4502B6 (CYP2B6) activity. J Clin Pharmacol 48:464–474. [DOI] [PubMed] [Google Scholar]
- Kharasch EDWD, Whittington D, Ensign D, Hoffer C, Bedynek PS, Campbell S, Stubbert K, Crafford A, London A, Kim T (2012) Mechanism of efavirenz influence on methadone pharmacokinetics and pharmacodynamics. Clin Pharmacol Ther 91:673–684. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li H, Ferguson SS, Wang H (2010) Synergistically enhanced CYP2B6 inducibility between a polymorphic mutation in CYP2B6 promoter and pregnane X receptor activation. Mol Pharmacol 78:704–713. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maganda BA, Minzi OM, Ngaimisi E, Kamuhabwa AA, Aklillu E (2016) CYP2B6*6 genotype and high efavirenz plasma concentration but not nevirapine are associated with low lumefantrine plasma exposure and poor treatment response in HIV-malaria-coinfected patients. Pharmacogenomics J 16:88–95. [DOI] [PubMed] [Google Scholar]
- Marzolini C, Telenti A, Decosterd LA, Greub G, Biollaz J, Buclin T (2001) Efavirenz plasma levels can predict treatment failure and central nervous system side effects in HIV-1-infected patients. AIDS 15:71–75. [DOI] [PubMed] [Google Scholar]
- Masters ARGB, Gufford BT, Lu JB, Metzger IF, Jones DR, Desta Z (2016a) Chiral plasma pharmacokinetics and urinary excretion of bupropion and metabolites in healthy volunteers. J Pharmacol Exp Ther 358:230–238. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Masters ARMM, McCoy M, Jones DR, Desta Z (2016b) Stereoselective method to quantify bupropion and its three major metabolites, hydroxybupropion, erythro-dihydrobupropion, and threo-dihydrobupropion using HPLC-MS/MS. J Chromatogr B Analyt Technol Biomed Life Sci 1015–1016:201–208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Metzger IF, Dave N, Kreutz Y, Lu JBL, Galinsky RE, Desta Z (2019) CYP2B6 Genotype-Dependent Inhibition of CYP1A2 and Induction of CYP2A6 by the Antiretroviral Drug Efavirenz in Healthy Volunteers. Clin Transl Sci 12:657–666. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Metzger IFLJ, Kreutz Y, Thong N, Flockhart DA, Desta Z (2013) CYP2B6 genetic variation and efavirenz autoinduction influences CYP2B6 activity and efavirenz exposure in healthy volunteers. Clin Pharmacol Ther 93:abstract S80. [Google Scholar]
- Meyer A, Vuorinen A, Zielinska AE, Strajhar P, Lavery GG, Schuster D, Odermatt A (2013) Formation of threohydrobupropion from bupropion is dependent on 11β-hydroxysteroid dehydrogenase 1. Drug Metab Dispos 41:1671–1678. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Meyer zu Schwabedissen HEOS, Oswald S, Bresser C, Nassif A, Modess C, Desta Z, Ogburn ET, Marinova M, Lütjohann D, Spielhagen C, et al. (2012) Compartment-specific gene regulation of the CAR inducer efavirenz in vivo [published correction appears in Clin Pharmacol Ther (2013) 93:129]. Clin Pharmacol Ther 92:103–111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Michaud V, Ogburn E, Thong N, Aregbe AO, Quigg TC, Flockhart DA, Desta Z (2012) Induction of CYP2C19 and CYP3A activity following repeated administration of efavirenz in healthy volunteers. Clin Pharmacol Ther 91:475–482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Neary M, Chappell CA, Scarsi KK, Nakalema S, Matovu J, Achilles SL, Chen BA, Siccardi M, Owen A, Lamorde M (2019) Effect of patient genetics on etonogestrel pharmacokinetics when combined with efavirenz or nevirapine ART. J Antimicrob Chemother 74:3003–3010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Neary M, Lamorde M, Olagunju A, Darin KM, Merry C, Byakika-Kibwika P, Back DJ, Siccardi M, Owen A, Scarsi KK (2017) The Effect of Gene Variants on Levonorgestrel Pharmacokinetics When Combined With Antiretroviral Therapy Containing Efavirenz or Nevirapine. Clin Pharmacol Ther 102:529–536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ngaimisi E, Mugusi S, Minzi O, Sasi P, Riedel KD, Suda A, Ueda N, Janabi M, Mugusi F, Haefeli WE, et al. (2011) Effect of rifampicin and CYP2B6 genotype on long-term efavirenz autoinduction and plasma exposure in HIV patients with or without tuberculosis. Clin Pharmacol Ther 90:406–413. [DOI] [PubMed] [Google Scholar]
- Ngaimisi E, Mugusi S, Minzi OM, Sasi P, Riedel KD, Suda A, Ueda N, Janabi M, Mugusi F, Haefeli WE, et al. (2010) Long-term efavirenz autoinduction and its effect on plasma exposure in HIV patients. Clin Pharmacol Ther 88:676–684. [DOI] [PubMed] [Google Scholar]
- Ogburn ET, Jones DR, Masters AR, Xu C, Guo Y, Desta Z (2010) Efavirenz primary and secondary metabolism in vitro and in vivo: identification of novel metabolic pathways and cytochrome P450 2A6 as the principal catalyst of efavirenz 7-hydroxylation. Drug Metab Dispos 38:1218–1229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Robarge JD, Metzger IF, Lu J, Thong N, Skaar TC, Desta Z, Bies RR (2017) Population Pharmacokinetic Modeling To Estimate the Contributions of Genetic and Nongenetic Factors to Efavirenz Disposition. Antimicrob Agents Chemother 61:e01813–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Robertson SM, Maldarelli F, Natarajan V, Formentini E, Alfaro RM, Penzak SR (2008) Efavirenz induces CYP2B6-mediated hydroxylation of bupropion in healthy subjects. J Acquir Immune Defic Syndr 49:513–519. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rotger M, Tegude H, Colombo S, Cavassini M, Furrer H, Décosterd L, Blievernicht J, Saussele T, Günthard HF, Schwab M, et al. (2007) Predictive value of known and novel alleles of CYP2B6 for efavirenz plasma concentrations in HIV-infected individuals. Clin Pharmacol Ther 81:557–566. [DOI] [PubMed] [Google Scholar]
- Sager JE, Price LS, Isoherranen N (2016) Stereoselective Metabolism of Bupropion to OH-bupropion, Threohydrobupropion, Erythrohydrobupropion, and 4′-OH-bupropion in vitro. Drug Metab Dispos 44:1709–1719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sager JE, Tripathy S, Price LS, Nath A, Chang J, Stephenson-Famy A, Isoherranen N (2017) In vitro to in vivo extrapolation of the complex drug-drug interaction of bupropion and its metabolites with CYP2D6; simultaneous reversible inhibition and CYP2D6 downregulation. Biochem Pharmacol 123:85–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sharma D, Lau AJ, Sherman MA, Chang TK (2013) Agonism of human pregnane X receptor by rilpivirine and etravirine: comparison with first generation non-nucleoside reverse transcriptase inhibitors. Biochem Pharmacol 85:1700–1711. [DOI] [PubMed] [Google Scholar]
- Silverstone PH, Williams R, McMahon L, Fleming R, Fogarty S (2008) Convulsive liability of bupropion hydrochloride metabolites in Swiss albino mice. Ann Gen Psychiatry 7:19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vitoria M, Hill A, Ford N, Doherty M, Clayden P, Venter F, Ripin D, Flexner C, Domanico PL (2018) The transition to dolutegravir and other new antiretrovirals in low-income and middle-income countries: what are the issues? AIDS 32:1551–1561. [DOI] [PubMed] [Google Scholar]
- Ward BA, Gorski JC, Jones DR, Hall SD, Flockhart DA, Desta Z (2003) The cytochrome P450 2B6 (CYP2B6) is the main catalyst of efavirenz primary and secondary metabolism: implication for HIV/AIDS therapy and utility of efavirenz as a substrate marker of CYP2B6 catalytic activity. J Pharmacol Exp Ther 306:287–300. [DOI] [PubMed] [Google Scholar]
- Xu C, Desta Z (2013) In vitro analysis and quantitative prediction of efavirenz inhibition of eight cytochrome P450 (CYP) enzymes: major effects on CYPs 2B6, 2C8, 2C9 and 2C19. Drug Metab Pharmacokinet 28:362–371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu C, Ogburn ET, Guo Y, Desta Z (2012) Effects of the CYP2B6*6 allele on catalytic properties and inhibition of CYP2B6 in vitro: implication for the mechanism of reduced efavirenz metabolism and other CYP2B6 substrates in vivo. Drug Metab Dispos 40:717–725. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu H, Loboz KK, Gross AS, McLachlan AJ (2007) Stereoselective analysis of hydroxybupropion and application to drug interaction studies. Chirality 19:163–170. [DOI] [PubMed] [Google Scholar]
- Zakaria Z, Badhan RKS (2018) The impact of CYP2B6 polymorphisms on the interactions of efavirenz with lumefantrine: Implications for paediatric antimalarial therapy. Eur J Pharm Sci 119:90–101. [DOI] [PubMed] [Google Scholar]
- Zhu AZ, Zhou Q, Cox LS, Ahluwalia JS, Benowitz NL, Tyndale RF (2014) Gene variants in CYP2C19 are associated with altered in vivo bupropion pharmacokinetics but not bupropion-assisted smoking cessation outcomes. Drug Metab Dispos 42:1971–1977. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu M, Kaul S, Nandy P, Grasela DM, Pfister M (2009) Model-based approach to characterize efavirenz autoinduction and concurrent enzyme induction with carbamazepine. Antimicrob Agents Chemother 53:2346–2353. [DOI] [PMC free article] [PubMed] [Google Scholar]






