TABLE 1.
Bacterial strains, plasmids, and primers used in this study
| Strain, plasmid, or primer | Relevant information | Source or reference |
|---|---|---|
| E. coli DH5α | hsdR recA lacZYA φ80 lacZΔM15 | GIBCO-BRL |
| P. aeruginosa | ||
| PAK | Wild-type clinical isolate | D. Bradley |
| PAO1 | Wild type | M. Vasil |
| PAK-Q | PAK fleQ::Gmr | 5 |
| PAK-N | PAK fleN::Gmr | This study |
| PAO-N | PAO fleN::Gmr | This study |
| Plasmids | ||
| pGEM3Zf(+) | Cloning vector, Ampr, LacZα peptide | Promega Corp., Madison, Wis. |
| pGEM-fleN | pGEM3Zf(+) with a 2.0-kb PCR product (fleN locus) cloned into the EcoRI/BamHI sites | This study |
| pGEM-fleNG | pGEM-fleN with a gentamicin resistance gene inserted in the unique EcoRV site of fleN | This study |
| pPZ375 | oriV in pGEM3Zf(+) | 35 |
| pPZ375-fleN | pPZ375 containing fleN as a 1.0-kb HindIII/SstI PCR fragment | This study |
| pET15bVP | oriV cloned as a PstI fragment in bla of pET15b | 5 |
| pET-fleN | fleN inserted as a PCR product into the NdeI/BamHI sites of pET15bVP | This study |
| pDN19lacΩ | Promoterless lacZ oriV oriT Tetr Strr Ω fragment | 37 |
| placΩQ | pDN19lacΩ containing the fleQ promoter region | 5 |
| placΩS | pDN19lacΩ containing the fleSR promoter region | 5 |
| placΩE | pDN19lacΩ containing the fliEFG promoter region | 4 |
| placΩD | pDN19lacΩ containing the fliDSorf126 promoter region | 6 |
| placΩflgE | pDN19lacΩ containing the flgBCDE promoter region | This study |
| placΩL | pDN19lacΩ containing the fliLMNOPQ promoter region | This study |
| pMS565 | pDN19lacΩ containing the fliA promoter region | 33 |
| pPT269 | pDN19lacΩ containing the fliC promoter region | 37 |
| pMSZ5 | pDN19lacΩ containing the pilA promoter region | 15 |
| Primersa | ||
| pPAO4 | 5′ cccaaagaatTCCCGGCCAGTCGCTGAT 3′, EcoRI site incorporated | |
| pPAO5 | 5′ cccaaaggATCCGCCAGGGCCGCCTGG 3′, BamHI site incorporated | |
| flnHind | 5′ cccaaaaagcttGAGGACGTGGGAAGAAC 3′, HindIII site incorporated | |
| flnSst | 5′ cccaaagagCTCCAGAGGCCGCTGTC 3′, SstI site incorporated | |
| flnPst | 5′ GTGAGCCTGCAGGCACCGGAAGAGCC 3′, PstI naturally present | |
| flnNde | 5′ GACAACACAAcatATGAAGCAGATGGG 3′, NdeI site incorporated | |
| flnBam | 5′ CCTTGCTATACgggaTCCAGAGGCCGCTG 3′, BamHI site incorporated | |
| 5PfliLbgal | 5′ cccaaagaattcCTCGGGCGATGAGGAAC 3′, EcoRI site incorporated | |
| 3PfliLbgal | 5′ cccaaaggattcCTCGCCTCTTTCTTAGCC 3′, BamHI site incorporated | |
| RER 41 | 5′ cccaaagaattcGGGCTTGCCACCCTTGCC 3′, EcoRI site incorporated | |
| RER 42 | 5′ cccaaaggatccCGTTGGCCAGGTTGTTGG 3′, BamHI site incorporated |
a
In primer sequences, lowercase denotes nucleotides added or modified to facilitate restriction digestion at the sites marked in bold.