TABLE 1.
Assay | Target gene | Primer sequence | Concn (μM) | Significance |
---|---|---|---|---|
1 | mgpa | MGpa_F, CTTGAGCCTTTCTAACCGCTGCACT | 0.25 | Species identification |
MGpa_R, CAAGTCCAAGGGGTTAAGGTTTCAT | 0.25 | Species identification | ||
HBB | HBB_F, AGTGCTCGGTGCCTTTAGTGAT | 0.2 | Quality control of nucleic acid extraction | |
HBB_R, TGGCAAAGGTGCCCTTGA | 0.2 | Quality control of nucleic acid extraction | ||
parC | ParC_D87_F, CCCATGGTGATAGTTCCATTTAT | 0.5 | Supplementary test for distinguishing mutation S83N from D87N | |
ParC_D87_R, AGCTTTGGGACATTCTGATAATTG | 0.5 | Supplementary test for distinguishing mutation S83N from D87N | ||
2 | parC | ParC_S8_F, GGGAGATCATGGGGAAATACC | 0.0375 | Prediction of fluoroquinolone resistance |
ParC_S83_R, CAGCTTTGGGACATTCTGATA | 0.025 | Prediction of fluoroquinolone resistance | ||
ParC_S83_P, CCCCCATGGTGATATTTCCATTTATDRTGCAAa | 1 | Prediction of fluoroquinolone resistance |
3′-blocked oligonucleotide probe.