Key resources table.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain, strain background (Mus musculus) | Fabp7-CreER2 | Maruoka et al., 2011 | ||
Strain, strain background (M. musculus) | Gt(ROSA)26Sortm1(DTA)Jpmb/J | The Jackson Laboratory | RRID:IMSR_JAX:006331 | |
Strain, strain background (M. musculus) | B6.129-Kcnj10tm1Kdmc/J | Djukic et al., 2007 | RRID:IMSR_JAX:026826 | |
Strain, strain background (M. musculus) | Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo | Muzumdar et al., 2007 | RRID:IMSR_JAX:007576 | |
Strain, strain background (M. musculus) | C57Bl/6J | The Jackson Laboratory | RRID:IMSR_JAX:000664 | |
Antibody | Anti-BLBP (mouse monoclonal) | Abcam | Cat# ab131137 (discontinued); RRID:AB_11157091 | IF (1:500) |
Antibody | Anti-BLBP (rabbit polyclonal) | Abcam | Cat# ab32423; RRID:AB_880078 | IF (1:200) |
Antibody | Anti-Sox2 (rabbit polyclonal) | Active Motif | Cat# 39823, RRID:AB_2793356 | IF (1:500) |
Antibody | Anti-IBA1 (rabbit polyclonal) | WAKO | Cat# 019-19741; RRID:AB_839504 | IF (1:200) |
Antibody | Anti-Kir4.1 (rabbit polyclonal) | Alomone Labs | Cat# APC-035; RRID:AB_2040120 | IF (1:100) |
Antibody | Anti-pS6 (rabbit polyclonal) | Cell Signaling | Cat# 2215S; RRID:AB_916156 | IF (1:200) |
Antibody | Anti-tyrosine hydroxylase (mouse monoclonal) | Sigma | Cat# T2928; RRID:AB_477569 | IF (1:300) |
Antibody | Anti-tyrosine hydroxylase (rabbit polyclonal) | Millipore | Cat# ab152; RRID:AB_390204 | IF (1:300) |
Antibody | Anti-c-Fos (rabbit polyclonal) | Abcam | Cat# ab190289; RRID:AB_2737414 | IF (1:1000) |
Antibody | Anti-Sox10 (goat polyclonal) | R&D Systems | Cat# AF2864; RRID:AB_442208 | IF (1:50) |
Antibody | Anti-p-4E-BP-1 (rabbit monoclonal) | Cell Signaling | Cat# 2855T; RRID:AB_560835 | IF (1:200) |
Antibody | Anti-TrkA (rabbit polyclonal) | Millipore | Cat# 06-674; RRID:AB_310180 | IF (1:200) |
Antibody | Amersham ECL Rabbit IgG, HRP-linked whole Ab from donkey (rabbit polyclonal) | Cytiva | Cat# NA934; RRID:AB_772206 | DAB (1:200) |
Sequence-based reagent | Adra1a TaqMan Probe | Thermo Fisher | Assay ID: Mm00442668_m1 | |
Sequence-based reagent | Adra1b TaqMan Probe | Thermo Fisher | Assay ID: Mm00431685_m1 | |
Sequence-based reagent | Adra1d TaqMan Probe | Thermo Fisher | Assay ID: Mm01328600_m1 | |
Sequence-based reagent | Adra2a TaqMan Probe | Thermo Fisher | Assay ID: Mm00845383_s1 | |
Sequence-based reagent | Adra2b TaqMan Probe | Thermo Fisher | Assay ID: Mm00477390_s1 | |
Sequence-based reagent | Adra2c TaqMan Probe | Thermo Fisher | Assay ID: Mm00431686_s1 | |
Sequence-based reagent | Adrb1 TaqMan Probe | Thermo Fisher | Assay ID: Mm00431701_s1 | |
Sequence-based reagent | Adrb2 TaqMan Probe | Thermo Fisher | Assay ID: Mm02524224_s1 | |
Sequence-based reagent | Adrb3 TaqMan Probe | Thermo Fisher | Assay ID: Mm02601819_g1 | |
Sequence-based reagent | Eukaryotic Rn18s Endogenous Control (VIC/MGB probe, primer limited) | Thermo Fisher | Cat# 4319413E | |
Sequence-based reagent | Th_F | This paper | qPCR primers | AATCCACCACTTAGAGACCCG (‘Materials and methods’) |
Sequence-based reagent | Th_R | This paper | qPCR primers | CTTGGTGACCAGGTGGTGAC (‘Materials and methods’) |
Sequence-based reagent | DBH_F | This paper | qPCR primers | CATCTGGATTCCCAGCAAGACT (‘Materials and methods’) |
Sequence-based reagent | DBH_R | This paper | qPCR primers | CAGCGACTGAAATGGCTCTTCC (‘Materials and methods’) |
Sequence-based reagent | Rn18s_F | Ceasrine et al., 2018 | qPCR primers | CGCCGCTAGAGGTGAAATTC |
Sequence-based reagent | Rn18s _R | Ceasrine et al., 2018 | qPCR primers | TTGGCAAATGCTTTCGCTC |
Sequence-based reagent | Kcnj10_F | Harvard Primer Bank | PrimerBank ID:34328498a1 | GTCGGTCGCTAAGGTCTATTACA |
Sequence-based reagent | Kcnj10_R | Harvard Primer Bank | PrimerBank ID:34328498a1 | GGCCGTCTTTCGTGAGGAC |
Sequence-based reagent | Fabp7CreER2 _F | Maruoka et al., 2011 | PCR primers | TACCGGTCGACAACGAGTGATGAGG |
Sequence-based reagent | Fabp7CreER2 _R | Maruoka et al., 2011 | PCR primers | GACCGACGATGCATGTTTAGCTGG |
Sequence-based reagent | Gt(ROSA)26Sortm1(DTA)Jpmb/J _F | The Jackson Laboratory | PCR primers | AAAGTCGCTCTGAGTTGTTAT |
Sequence-based reagent | Gt(ROSA)26Sortm1(DTA)Jpmb/J _R | The Jackson Laboratory | PCR primers | GCGAAGAGTTTGTCCTCACC |
Sequence-based reagent | B6.129-Kcnj10tm1Kdmc/J _F | The Jackson Laboratory | PCR primers | TGATCTATCTCGATTGCTGC |
Sequence-based reagent | B6.129-Kcnj10tm1Kdmc/J _R | The Jackson Laboratory | PCR primers | CCCTACTCAATGCTCTTAAC |
Sequence-based reagent | Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo_WT F | The Jackson Laboratory | PCR primers | GGC TTA AAG GCT AAC CTG ATG TG |
Sequence-based reagent | Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo_WT R | The Jackson Laboratory | PCR primers | GGA GCG GGA GAA ATG GAT ATG |
Sequence-based reagent | Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo_Mut F | The Jackson Laboratory | PCR primers | CCG GAT TGA TGG TAG TGG TC |
Sequence-based reagent | Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo_Mut R | The Jackson Laboratory | PCR primers | AAT CCA TCT TGT TCA ATG GCC GAT C |
Chemical compound, drug | Hydrogen peroxide solution, 30% in H2O, ACS reagent | Sigma-Aldrich | Cat# 216763 | |
Chemical compound, drug | SIGMAFAST 3,3'-Diaminobenzidine tablets, tablet, to prepare 15 mL | Sigma-Aldrich | Cat# D4418-50SET | |
Chemical compound, drug | 6-Hydrodroxydopamine hydrobromide | Hello Bio | Cat# HB1889 | |
Chemical compound, drug | Hematoxylin solution | Sigma-Aldrich | Cat# GHS232 | |
Chemical compound, drug | Bouin’s solution | Sigma-Aldrich | Cat# HT10132-1L | |
Chemical compound, drug | Glycogen | Thermo Fisher | Cat# R0551 | |
Chemical compound, drug | Maxima SYBR Green/ROX qPCR Master Mix (2×) | Thermo Fisher | Cat# K0222 | |
Chemical compound, drug | TaqMan Universal PCR Master Mix | Thermo Fisher | Cat# 4304437 | |
Chemical compound, drug | Trizol | Thermo Fisher | Cat# 15596018 | |
Other | DAPI | Roche | Cat# 10236276001 | (1 µg/mL) |
Chemical compound, drug | Agarose, low EEO | Sigma | Cat# A0576-25G | |
Chemical compound, drug | ProLong Gold Antifade Mountant | Thermo Fisher | Cat# P36930 | |
Chemical compound, drug | Permount Mounting Media | Fisher Scientific | Cat# SP11500 | |
Chemical compound, drug | Flouromount Mounting Media | Sigma-Aldrich | Cat# F4680-25mL | |
Commercial assay or kit | Click-iT EdU Alexa Fluor 555 Imaging Kit | Life Technologies | Cat# 10338 | |
Commercial assay or kit | In Situ Cell Death Detection Kit, TMR red | Roche | Cat# 12156792910 | |
Commercial assay or kit | Norepinephrine Research ELISA | Rocky Mountain Diagnostics, Inc | BA E-5200 | |
Commercial assay or kit | Superscript IV First Strand Synthesis System | Thermo Fisher | Cat# 18091050 | |
Commercial assay or kit | Agilent Absolutely RNA Nanoprep Kit | Agilent | Cat# 400753 | |
Commercial assay or kit | RNAscope Fluorescent Multiplex Assay | ACD | Cat# 320850 | |
Commercial assay or kit | RNAscope Probe-Kcnj10-C3 | ACD | Cat# 458831-C3 | |
Software, algorithm | LabChart 8 software (ADInstruments) | N/A | https://www.adinstruments.com/support/software | |
Software, algorithm | ImageJ | N/A | https://imagej.nih.gov/ij/ | |
Software, algorithm | ZEN 2012 SP1 (black edition) | N/A | https://www.zeiss.com/microscopy/int/home.html | |
Software, algorithm | ZEN 2012 (blue edition) | N/A | https://www.zeiss.com/microscopy/int/home.html |