Table 3.
attB sites of cluster MabR prophage.
| attBa | Core sequenceb | Prophagesc | Genomic featured | Coordinatesd |
|---|---|---|---|---|
| attB-18 | CTGGTGCGCCGTCAGGGGCTCGAACCCCGGACCCGCTGATTAAGAGTC | McProf, prophiFSAT01-1, prophiFVLQ01-1 | Mab_t5022c; 3′ end tRNA-Lys | 1,550,157–1,550,204 |
| attB-22 | TGCGCCGTCAGGGTTTCGAACCCCAGACCCGCTGATTAAGAGTCA | prophiFSIL01-1 | Mab_t5030c; 3′ half of tRNA-Lys | 2,089,033–2,089,077 |
| attB-23 | CCCCACCAGGGCTCGAACCTGGGACCTGCGGATTAAAAGTCCG | prophiFSQJ01-1 | In Mab_0771c | 770,355–770,397 |
a
attB-18 was identified by Dedrick et al. (2021).
b
Sequence shared between attL and attR sites within and near the genomic feature for each attB site; mismatches are shown in bold. Novel attB sites (attB 19, 20) have no mismatches when aligning to attR sites in their respective phage.
c
As defined in Table 2.
d
Genes and coodinates in the M. abscessus strain ATCC1997.