Experimental Models
|
E14TG2a mESC (Mus musculus) |
ATCC |
CRL‐1821 |
HEK293T (Homo sapiens) |
ATCC |
CRL‐3216 |
Recombinant DNA
|
psiCHECK2‐mMov10‐3'UTR (WT) (mMov10 3'UTR) |
Addgene this study |
Cat # 178905 |
psiCHECK2‐mMOV103'UTR‐MRE16‐mut1 |
Addgene this study |
Cat # 178906 |
psiCHECK2‐mMOV103'UTR‐MRE153‐mut4 |
Addgene this study |
Cat # 178909 |
psiCHECK2‐mMOV103'UTR‐MRE16+MRE153‐mut |
Addgene this study |
Cat # 178910 |
pCDNA3‐T11HA‐hMOV10‐WT (human Mov10 cDNA) |
Addgene this study |
Cat # 178907 |
T10‐T7‐hMOV10 (human Mov10 cDNA) |
Addgene this study |
Cat # 185052 |
T11‐HA‐hORF1 (human L1 ORF1p cDNA) |
Addgene this study |
Cat # 185053 |
pCEP‐L1SM‐WT (hygro) (mouse L1 neoR cassette) |
Maclennan et al (2017) |
|
JJ‐L1SM WT (mouse L1 BlastR cassette) |
Maclennan et al (2017) |
|
JJ‐L1SM N21A (mouse nutant L1 BlastR cassette) |
Maclennan et al (2017) |
|
pKLV‐U6gRNA(BbsI)‐PGKpuro2ABFP‐L1mono3
|
Addgene this study |
Cat # 73542 |
pKLV‐U6gRNA(BbsI)‐PGKpuro2ABFP‐L1mono1
|
Addgene this study |
Cat # 73543 |
Antibodies
|
rabbit polyclonal anti‐ORF1p (IF 1:1,000, WB 1:4,000) |
kind gift from Prof. O'Carroll |
NA |
mouse monoclonal 15C1BB anti‐MOV10 (IF 1:500) |
Bethyl Laboratories Inc |
A500‐009A‐T |
rabbit polyclonal anti‐G3BP1 (IF 1:500) |
Bethyl Laboratories Inc |
A302‐033A |
rabbit polyclonal anti‐LC3B antibody (IF 1:250) |
Cell Signaling Technology |
2775 |
rabbit polyclonal anti‐DDX6 (IF 1:500) |
GeneTex |
GTX102795 |
rat monoclonal anti‐HA (IF 1:500) |
Roche |
3F10 |
Rabbit monoclonal T7‐Tag (D9E1X) XP (IF 1:250) |
Cell Signaling Technology |
13246 |
Goat anti‐RENT1 antibody (IF 1:250) |
Bethyl laboratories |
A300‐038A |
Alexa fluor 488 goat anti‐rat IgG (IF 1:4,000) |
Life Technologies |
11006 |
Alexa fluor 488 donkey anti‐mouse IgG (IF 1:4,000) |
Life Technologies |
A21202 |
Alexa fluor 546 donkey anti‐rabbit IgG (IF 1:4,000) |
Life Technologies |
A10040 |
Alexa fluor 647 donkey anti‐mouse IgG (IF 1:4,000) |
Life Technologies |
A31571 |
Alexa fluor 488 donkey anti‐goat IgG (IF 1:4,000) |
Life Technologies |
A11055 |
rabbit anti MOV10 antibody (WB 1:2,000) |
Proteintech |
10370‐1‐AP |
rabbit polyclonal anti‐Dicer (WB 1:2,000) |
Sigma |
SAB42000087 |
rabbit polyclonal anti‐Argonaute2 (WB 1:2,000) |
Cell Signaling Technologies |
C34C6 |
rabbit anti‐Drosha (WB 1:2,000) |
Cell Signaling Technologies |
D28B1 |
mouse anti‐Tubulin antibody (WB 1:10,000) |
GenScript |
A01410 |
rabbit anti‐LaminB1 (WB 1:5,000) |
Abcam |
ab16048 |
anti‐rabbit IgG HRP‐linked (WB 1:10,000) |
Cell Signaling Technologies |
7076 |
anti‐rat IgG HRP‐linked antibody (WB 1:10,000) |
Cell Signaling Technologies |
7077 |
Oligonucleotides and sequence‐based reagents
|
Experiment
|
Fwd Primer
|
Rev Primer
|
mMOV10 3'UTR PCR amplification |
taggcgatcgctcgaggccacagccgcccgcctt |
ttgcggccagcggccttttgcatagaacagcattttgt |
miR16‐5p (CTG>AGT) mut1 mutageneis |
acccaagagtctaaaactcggaggaaggggg |
tttagactcttgggttgtcttccctagc |
miR153‐3p (TGC>CAT) mut4/mut1+mut4 mutagenesis |
tgttctacataaaaggccgctggccgca |
cttttatgtagaacagcattttgtttttctt |
hMOV10 cDNA PCR amplification |
ggtcggaggcggatccatgcccagtaagttcagctgc |
gatatctgcagaattctcagagctcattcctccactc |
hORF1 cDNA PCR amplification |
ggtcggaggcggatccatggggaaaaaacagaac |
gatatctgcagaattctcattacattttggcatgattttgc |
Guide RNA L1UP mono3 |
caccgccagagaacctgacagcttc |
|
Guide RNA L1UP mono1 |
caccgccagaggacaggtgcccgcc |
|
mmu‐miR‐16‐5p mimic |
uagcagcacguaaauauuggcg |
|
mmu‐miR‐30e‐5p mimic |
uguaaacauccuugacuggaag |
|
mmu‐miR‐138‐5p mimic |
agcugguguugugaaucaggccg |
|
mmu‐miR‐153‐3p mimic |
uugcauuagucacaaaagugauc |
|
miRIDIAN microRNA negative control 1 |
catalog no CN‐001000‐01‐05 |
|
qPCR Rrm2 |
ccgagctggaaagtaaagcg |
atgggaaagacaacgaagcg |
qPCR Mov10 |
gacgatttacaaccacgacttca |
gccagatttgcgatcttcattcc |
qPCR Dicer |
ccgatgatgcagcctctaatag |
tccatctcgagcaattctctca |
qPCR L1‐Tf |
cagcggtcgccatcttg |
caccctctcacctgttcagactaa |
qPCR L1‐A |
ggattccacacgtgatcctaa |
tcctctatgagcagacctgga |
qPCR L1‐Gf |
ctccttggctccgggact |
caggaaggtggccggttgt |
qPCR L1‐ORF1 |
actcaaagcgaggcaacact |
ctttgattgttgtgccgatg |
qPCR L1‐ORF2 |
ggagggacatttcattctcatca |
gctgctcttgtatttggagcataga |
NB L1specifc |
gagtttttgagtctgtatcc |
ctctccttagtttcagtgg |
Chemicals, enzymes and other reagents
|
Fibronectin |
Sigma |
FC010 |
Puromycin |
Sigma |
P8833 |
Hygromycin |
Invitrogen |
10687010 |
G418 |
Invitrogen |
10131035 |
Blasticidin |
Invitrogen |
R21001 |
DMEM Media |
Sigma |
D6429‐500ML |
Penicillin/Streptomycin |
Sigma |
P0781‐100ML |
0.05% Trypsin‐EDTA |
Life Technologies |
25300054 |
PBS1X |
Life Technologies |
10010015 |
2‐ß‐mercaptoethanol |
Life Technologies |
31350010 |
FBS |
Life Technologies |
10270‐106 |
Lipofectamine™ RNAiMAX Transfection Reagent |
Life Technologies |
13778030 |
Lipofectamine™ 2000 Transfection Reagent |
Life Technologies |
11668019 |
Lipofectamine™ 3000 Transfection Reagent |
Life Technologies |
L3000015 |
1,6‐Hexanediol |
Sigma |
H11807 |
Sodium Arsenite |
Sigma |
S7400 |
Tris(carboxyethyl)phosphine |
Sigma |
68957 |
Tris‐HCl |
AppliChem |
A2937 |
NaCl |
Merck |
1.06404.1000 |
MgCl2
|
Sigma |
M8266 |
IGEPAL CA‐630 |
Sigma |
I3021‐50ML |
Sodium dodecyl sulfate |
Sigma |
L6026 |
Protease inhibitor cocktails |
Roche |
5892791001 |
Tween20 |
Sigma |
P1379 |
Coomassie |
VWR |
443283M |
Triton‐X |
Sigma |
93443 |
PIPES |
Sigma |
80635 |
NotI‐HF |
NEB |
R3189S |
BamH1‐HF |
NEB |
R3136 |
XhoI‐HF |
NEB |
R0146 |
EcoRI‐HF |
NEB |
R0101 |
Bbs1 |
NEB |
R0539 |
In‐Fusion® Snap Assembly Master Mix |
Takara |
638944 |
CloneAmp HiFi PCR Premix |
Takara |
639298 |
Vectashield |
Vector Laboratories |
H‐1000 |
DAPI |
Sigma |
D9542 |
Trizol |
Life Technologies |
15596018 |
Nick translation kit |
Abbot Molecular |
06J40‐020 |
Red‐dUTP |
Enzo Life sciences |
ENZ 42854 |
Ribonucleoside Vanadyl Complex |
NEB |
S1420S |
Trisodium citrate |
Sigma |
S4641 |
DNA Clean & Concentrator‐25
|
Zymo Research |
D4033 |
Clarify™ Western ECL substrate |
BioRad |
1705060 |
SuperSignal™ West Femto Maximum Sensitivity Substrate |
Therno Scientific |
34094 |
RQ1 Rnase‐Free DNase kit |
Promega |
M6101 |
GoScript™ Reverse Transcriptase Kit |
Promega |
A5001 |
KAPA SYBR® FAST qPCR Kit Optimized for Light Cycler® 480 |
KAPA Biosystems, Sigma |
KK4610 |
PerfectHybTM Plus |
Sigma |
H7033 |
Dual‐Glow Luciferase Assay kit |
Promega |
E2920 |
Crystal Violet |
Sigma |
1014080025 |
Software
|
Prism 9.2.0 |
GraphPad |
https://www.graphpad.com
|
Fiji |
Fiji ImageJ |
Nature Methods, 9(7), 676–682 |
Microsoft Excel |
Microsoft |
|
ImageLab v6.1.0 |
Bio‐Rad Laboratories |
https://www.bio‐rad.com
|
Other
|
GloMax® Discover Multimode Microplate Reader |
Promega |
|
Roche Light Cycler 480 |
Roche |
|