REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Human ACE-2 APC-conjugated Antibody	R&D Systems	Cat#FAB933A
Goat IgG APC-conjugated Antibody	R&D Systems	Cat#IC108A
Bacterial and virus strains
SARS-CoV-2 strain CA (spike mutations with reference to Wuhan-Hu-1: D218E, P323L, R203K, G204R, D614G)	Institute of Clinical Microbiology and Hygiene, University Hospital Regensburg	Clinical SARS-CoV-2 isolate, GenBank accession number: MZ675816
DH5α Competent Cells	Thermo Fisher Scientific Inc. (US)	18,263,012
Chemicals, peptides, and recombinant proteins
β-glucuronidase	Merck KGaA (DE)	Cat#3707580001
Alexa Fluor 647nm-coupled Cholera Toxin Subunit B	Thermo Fisher Scientific Inc. (US)
Alexa Fluor 488nm-coupled Cholera Toxin Subunit B	Thermo Fisher Scientific Inc. (US)	Cat#C34775
Accutase Cell Detachment Solution	Capricorn Scientific GmbH (DE)	Cat#ACC-1B
Phalloidin-AF647	Life Technologies GmbH (DE)	Cat#A22287
Fetal Calf Serum (FCS)	Capricorn Scientific GmbH (DE)	Cat#FCS-62A
Paraformaldehyde	Merck KGaA (DE)	Cat#158127
DAPI (HOECHST-Straining-Solution - Bis-Benzimide H33258)	Sigma-Aldrich (US)	Cat # 94,403-1ML
DAPI Fluoromount-G	SouthernBiotech	Cat# 0100-20
Dextran (10 kDa) coupled to Alexa Fluor 546 nm	Thermo Fisher Scientific Inc. (US)	Cat#D22911
Dextran (10 kDa) coupled to Alexa Fluor 647 nm	Thermo Fisher Scientific Inc. (US)	Cat#D22914
Trypsin	Capricorn Scientific GmbH (DE)	Cat#TRY-2B10
Ethylendiamintetraacetat (EDTA)	Merck KGaA (DE)	Cat#1084540100
Agarose, universal (peqGold)	VWR International (US)	Cat#PEQL35-1030AL
Cultrex Mouse Laminin I	R&D Systems/Bio Techne GmbH	Cat # 3400-010-02
Bovine Fibronectin	PromoCell	Cat#C-43060
Collagen I from calf-skin	Sigma-Aldrich (DE)	Cat#C8919
Cultrex Mouse Collagen IV	R&D Systems/Bio Techne GmbH	Cat#3410-010-02
Penicillin Streptomycin (10.000 U/ml)	Capricorn Scientific GmbH (DE)	Cat#PS-B (100 mL)
bisBenzimide H 33,258 (HOE 33258)	Merck (DE)	Cat#B2883-100MG
Glutaraldehyde 25%, solution in water	SERVA Electrophoresis GmbH (DE)	Cat#23114.02
Cacodylic acid sodium salt	Carl Roth GmbH + Co. KG (DE)	Cat#5169.2
Osmium tetroxide 4%, aqueous solution	Electron Microscopy Science (US)	Cat#19150
Epoxy embedding medium	Sigma-Aldrich (DE)	Cat#45345-1L-F
Epoxy embedding medium, hardener DDSA	Sigma-Aldrich (DE)	Cat#45346-250ML-F
Epoxy embedding medium, hardener MNA	Sigma-Aldrich (DE)	Cat#45347-1L-F
Glycidether Accelerator DMP-30	Carl Roth GmbH + Co. KG (DE)	Cat#8621.1
Uranyl acetate dihydrate	Merck (DE)	Cat#6159-44-0
Lipofectamine™ 3000	Thermo Fisher Scientific Inc. (US)	Cat#L3000008
X-TremeGene 9 Transfection Reagent	Sigma-Aldrich (US)	Cat# 06,365 779,001
Polybrene	EMD Millipore (US)	Cat#TR-1003-G
Puromycin	Sigma-Aldrich (US)	Cat#P8833
Alexa Fluor™ 532 Phalloidin F-actin	Thermo Fisher Scientific Inc. (US)	Cat# A22282
RNase inhibitor	Applied Biosystems, Darmstadt (DE)	Cat# N8080119
Taq-Path-Mix	Metabion international, Planegg (DE)	N/A
IGEPAL CA-630	VWR International, Radnor (US-PA)	Cat# J61055.AP
Remdesivir	Gilead Sciences	Pharmacy of the University Hospital Regensburg
Critical commercial assays
NucleoSpin® RNA Kit	Macherey-Nagel GmbH & Co. KG (DE)	Cat#REF740955.250
Reverse Transcription System	Promega Corporation (US)	Cat#A3500
Takyon™ No Rox SYBR® MasterMix dTTP Blue	Eurogentec (BE)	Cat# UF-NSMT-B0701
HiYield® PCR Clean-up/Gel Extraction Kit	Süd-Laborbedarf GmbH (DE)	Cat#30 HYDF100
HiYield® Plasmid Mini Kit	Süd-Laborbedarf GmbH (DE)	Cat#30 HYPD100
NucleoBond® Xtra Midi Plasmid purification Kit	Macherey-Nagel GmbH & Co. KG (DE)	Cat#REF740410.50
NucleoSpin® Gel and PCR Clean-up Kit	Macherey-Nagel GmbH & Co. KG (DE)	Cat#REF740609.50
Phusion Hot Start II High-Fidelity DNA Polymerase	Thermo Fisher Scientific Inc. (US)	Cat#F549S
Qiagen RNeasy Plus Mini kit	Qiagen	Cat#74004
Qiagen DNeasy Blood & Tissue Kits	Qiagen	Cat#69504
Experimental models: Cell lines
Human: HEK293T cells	David Sabatini’s lab	N/A
Mouse: mouse embryonic fibroblasts (MEF)	Stephan Storch (University Medical Center Hamburg-Eppendorf)	N/A
Human: fibroblast BJ line	ATCC, UK	Control: BJ CRL-2522
Human: fibroblast 1096-01 line	Dr. Timothy Yu (Boston Children’s Hospital, Boston MA)	Patient 1: 1096-01
Human: fibroblast BR3075 line	Dr. Benjamin Greenberg (UT Southwestern Medical Center, Dallas TX)	Patient 2: BR3075
Human: fibroblast BR2986 line	Dr. Benjamin Greenberg (UT Southwestern Medical Center, Dallas TX)	Patient 3: BR2986
African green monkey: Vero cells	Kindly provided by the Max-von-Pettenkofer-Institut, Munich	N/A
Oligonucleotides
Integrin α2-subdomain (human), NM_002203.4, se: TTAGCGCTCAGTCAAGGCAT	This paper	Invitrogen
Integrin α2-subdomain (human), NM_002203.4, as: TTGCTTCTGGGAGACCAACA	This paper	Invitrogen
Integrin β1-subdomain (human), NM_002211.4, se: GCCGCGCGGAAAAGATGA	This paper	Invitrogen
Integrin β1-subdomain (human), NM_002211.4, as: TTGAATTTGTGCACCACCCAC	This paper	Invitrogen
Discoidin Domain Receptor Tyrosin Kinase 2 (human) NM_001014796.3, se: TGCACCCGTTGATATGCCTC	This paper	Invitrogen
Discoidin Domain Receptor Tyrosin Kinase 2 (human) NM_001014796.3, as: GAGTCCAGCCAAAGGTCTCC	This paper	Invitrogen
Tenascin C (human), XM_017014678.2, se: TCTCGCCCATCGGAAAGAAAA	This paper	Invitrogen
Tenascin C (human), XM_017014678.2, as: GGCTCTAGGGCTCTAGGGTAT	This paper	Invitrogen
Syndecan 3 (human), NM_014654.4, se: GAGGTGCTCGTAGCTGTGATT	This paper	Invitrogen
Syndecan 3 (human), NM_014654.4, as: AGCAGTGTGACCAAGAAGGC	This paper	Invitrogen
GAPDH (human), se: CCCCGGTTTCTATAAATTGAGC	This paper	Invitrogen
GAPDH (human), as: CTTCCCCATGGTGTCTGAG	This paper	Invitrogen
CLN7/MFSD8 (mouse), se: CCCGGAAGCAGAGAATGGAG	This paper	Invitrogen
CLN7/MFSD8 (mouse), as: GGCCAGATGGACATTATCAC	This paper	Invitrogen
CLN7/MFSD8 (human), se: CACCTGGAAGCAGAGAATGG	This paper	Invitrogen
CLN7/MFSD8 (human), as: ACCCTACACTGCTGAGAAAC	This paper	Invitrogen
single guide RNA (sgRNA) that contains a targeting sequence for CLN7 gene:
sg CLN7_4 (S): caccgCTGGGCCAGATGAATCACCG	This paper	N/A
sg CLN7_4 (AS): aaacCGGTGATTCATCTGGCCCAGc	This paper	N/A
sg CLN7_9 (S): caccgTAGGCGACACACCTGGAAGC	This paper	N/A
sg CLN7_9 (AS): aaacGCTTCCAGGTGTGTCGCCTAc	This paper	N/A
CLN7-PAM-2-F: CCTGGTGCCTCTACACACCGGTG ATTCATCTGG	This paper	Metabion
CLN7-PAM-2-R: CCAGATGAATCACCGGTGTGTAGA GGCACCAGG	This paper	Metabion
SARS-CoV-2 E gene E_Sarbeco_F1: 5′-ACAGGTACGTT AATAGTTAATAGCGT-3′	Metabion international, Planegg (DE), N/A	Corman et al., (2020)
SARS-CoV-2 E gene E_Sarbeco_R2: 5′-ATATTGCAGCA GTACGCACACA-3′	Metabion international, Planegg (DE), N/A	Corman et al., (2020)
SARS-CoV-2 E gene E_Sarbeco_P1: FAM-ACACTAGCC ATCCTTACTGCGCTTCG-BBQ	Metabion international, Planegg (DE), N/A	Corman et al., (2020)
CLN7-EX2, se: 5′GAAACGGAGGGAGGAAGACA-3′	This paper	Invitrogen
CLN7-Ex2-In, as: 5′-CACCAGACTCAGGAGCCC-3′	This paper	Invitrogen
CLN7-EX11, se: 5′-TTTAACAGGATTGGCGAGCG-3′	This paper	Invitrogen
CLN7-EX11, as: 5′-ACCACAATGCCACTCCTACA-3′	This paper	Invitrogen
Recombinant DNA
pIRES2-AcGFP1 vector	Clontech Europe	Cat#632435
pLentiCRISPRv1	David Sabatini’s lab	N/A
ΔVPR lentiviral packaging plasmid	Addgene	8455
VSV-G envelope plasmid	Addgene	8454
Software and algorithms
ZEN Lite 2011 x64	Carl Zeiss AG, DE	https://www.zeiss.com/microscopy/int/products/microscope-software/zen-lite.html
ImageJ 2.0	Open source	https://imagej.nih.gov/ij/download.html
FlowJo Software Version 10	FlowJo	https://www.flowjo.com/
BD Accuri C6 Software	BD Biosciences	https://www.bdbiosciences.com/en-us/products/software
SnapGene	GSL Biotech	http://snapgene.com
Other
Leibovitz’s L-15-Gibco® medium	Thermo Fisher Scientific Inc. (US)	Cat#11570396
PBS	Capricorn Scientific GmbH (DE)	Cat#PBS-1A
Dulbecco's Phosphate Buffered Salin (DPBS)	Thermo Fisher Scientific Inc. (US)	Cat#J67802.K2
Minimum Essential Medium (MEM) with Earle salts and L-glutamine	Capricorn Scientific GmbH (DE)	Cat#MEM-A (500 mL)
Gibco® Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12)	Thermo Fisher Scientific Inc. (US)	Cat#12634028
Opti-MEM® I Medium	Thermo Fisher Scientific Inc. (US)	Cat#31985070
Dulbecco's Modified Eagle’s Medium	10% fetal calf serum (FCS), 0.3 mg/mL Glutamin, 200 U/ml Penicillin, 90 U/ml Streptomycin	Gibco, Darmstadt (DE), Cat# 41,966