| Antibody |
PE/Cyanine7 anti-mouse CD138 antibody (rat monoclonal) |
BioLegend |
Cat# 142514; RRID:AB_2562198
|
FACS (1:500) |
| Antibody |
Brilliant Violet 570 anti-mouse CD19 antibody (rat monoclonal) |
BioLegend |
Cat# 115535; RRID:AB_10933260
|
FACS (1:200) |
| Antibody |
PE/Cyanine7 anti-human CD38 antibody (HIT2) (mouse monoclonal) |
BioLegend |
Cat# 303516; RRID:AB_2072782
|
FACS (1.5 uL per test) |
| Antibody |
Alexa Fluor 488 anti-human IgD antibody (mouse monoclonal) |
BioLegend |
Cat# 348216; RRID:AB_11150595
|
FACS (1.5 uL per test) |
| Antibody |
APC anti-human CD19 antibody (HIB19) (mouse monoclonal) |
BioLegend |
Cat# 302212; RRID:AB_314242
|
FACS (1.5 uL per test) |
| Antibody |
Alexa Fluor 647 anti-mouse Blimp-1 antibody (rat monoclonal) |
BioLegend |
Cat# 150004; RRID:AB_2565618
|
FACS (1:100) |
| Antibody |
Alexa Fluor 488 anti-Pax-5 antibody (rat monoclonal) |
BioLegend |
Cat# 649705; RRID:AB_2562426
|
FACS (1:100) |
| Antibody |
Pacific Blue anti-IRF4 antibody (rat monoclonal) |
BioLegend |
Cat# 646418; RRID:AB_2814497
|
FACS (1:100) |
| Antibody |
PE anti-mouse CD138 (Syndecan-1) antibody (rat monoclonal) |
BioLegend |
Cat# 142504; RRID:AB_10916119
|
FACS (1:500) |
| Antibody |
PE anti-mouse IL-21R antibody (rat monoclonal) |
BioLegend |
Cat# 131905; RRID:AB_1279431
|
FACS (1:200) |
| Antibody |
Alexa Fluor 647 anti-STAT3 phospho (Tyr705) antibody (mouse monoclonal) |
BioLegend |
Cat# 651007; RRID:AB_2572085
|
FACS (1:20) |
| Antibody |
PE anti-mouse Blimp-1 antibody (rat monoclonal) |
BioLegend |
Cat# 150005; RRID:AB_2565991
|
FACS (1:100) |
| Antibody |
Alexa Fluor 647 anti-Pax-5 antibody (rat monoclonal) |
BioLegend |
Cat# 649703; RRID:AB_2562424
|
FACS (1:100) |
| Antibody |
Anti-CMS antisera (rabbit polyclonal) |
Dr. Anjana Rao |
PMID:23018193
|
Dot blot (1:3000) |
| Antibody |
Goat anti-mouse IgM-UNLB 1 mg (goat polyclonal) |
SouthernBiotech |
Cat# 1021-01; RRID:AB_2687524
|
ELISA (1:1000) |
| Antibody |
Goat anti-mouse IgG Fc-UNLB 1 mg (goat polyclonal) |
SouthernBiotech |
Cat# 1033-01; RRID:AB_2794330
|
ELISA (1:1000) |
| Antibody |
AffiniPure donkey anti-mouse IgG (H+L) HRP (donkey polyclonal) |
Jackson ImmunoResearch |
Cat# 715-035-150; RRID:AB_2340770
|
ELISA (1:5000) |
| Antibody |
Goat anti-mouse IgG Fc-biotin (goat polyclonal) |
SouthernBiotech |
Cat# 1033-08; RRID:AB_2794333
|
ELISA (1:5000) |
| Antibody |
Phospho-Stat3 (Tyr705) (D3A7) XP (rabbit monoclonal) |
Cell Signaling Technology |
Cat# 9145; RRID:AB_2491009
|
ChIP (10 µL) |
| Antibody |
Ultra-LEAF purified anti-human CD40 (mouse monoclonal) |
BioLegend |
Cat# 334350; RRID:AB_2810512
|
1 or 100 ng/mL |
| Antibody |
PE/Cyanine7 anti-mouse CD138 antibody (rat monoclonal) |
BioLegend |
Cat# 142514; RRID:AB_2562198
|
FACS (1:500) |
| Antibody |
AffiniPure F(ab')₂ fragment goat anti-human IgG +IgM (H+L) (goat polyclonal) |
Jackson ImmunoResearch |
Cat# 109-006-127; RRID:AB_2337552
|
2.6 µg/mL |
| Antibody |
Anti-mouse CD16/CD32 antibody 2.4G2 (rat monoclonal) |
BioXCell |
Cat# BE0307; RRID:AB_2736987
|
FACS (1:100) |
| Cell line (Mus musculus) |
40LB |
Nojima et al., 2011
|
PMID:21897376
|
|
| Chemical compound or drug |
Gibco DMEM |
Thermo Fisher |
Cat# 11995-065 |
|
| Chemical compound or drug |
Fetal bovine serum (FBS) |
Gemini Bio |
Cat# 100-106 |
|
| Chemical compound or drug |
GlutaMAX |
Thermo Fisher |
Cat# 35050061 |
|
| Chemical compound or drug |
RPMI 1640 |
Thermo Fisher |
Cat# 61870127 |
|
| Chemical compound or drug |
MEM non-essential amino acids solution (100×) |
Thermo Fisher |
Cat# 11140050 |
|
| Chemical compound or drug |
Sodium pyruvate (100 mM) |
Thermo Fisher |
Cat# 25-000CI |
|
| Chemical compound or drug |
Gentamicin (50 mg/mL) |
Thermo Fisher |
Cat# 15750060 |
|
| Chemical compound or drug |
2-Mercaptoethanol |
MilliporeSigma |
Cat# M3701 |
|
| Chemical compound or drug |
B-27 supplement (50×), serum free |
Thermo Fisher |
Cat# 17504044 |
|
| Chemical compound or drug |
B-27 supplement (50×), minus antioxidants |
Thermo Fisher |
Cat# 10889038 |
|
| Chemical compound or drug |
L-ascorbic acid 2-phosphate (P-AA; VC) |
MilliporeSigma |
Cat# 49572 |
|
| Chemical compound or drug |
L-ascorbic acid (L-AA) |
MilliporeSigma |
Cat# A92902 |
|
| Chemical compound or drug |
Erythorbic acid (EA) |
MilliporeSigma |
Cat# 856061 |
|
| Chemical compound or drug |
Lipopolysaccharides from Escherichia coli O55:B5 purified by phenol extraction |
MilliporeSigma |
Cat# L2880 |
|
| Chemical compound or drug |
Phosphate-based saline (PBS) |
Thermo Fisher |
Cat# 10010-023 |
|
| Chemical compound or drug |
Ficoll-Paque Plus |
Cytiva |
Cat# 17144002 |
|
| Chemical compound or drug |
PANSORBIN (S. aureus Cowan I) |
MilliporeSigma |
Cat# 507862 |
0.01% |
| Chemical compound or drug |
ODN 2006 (ODN 7909) |
Invivogen |
Cat# tlrl-2006 |
2.5 µM |
| Chemical compound or drug |
HEPES (1 M) |
Thermo Fisher |
Cat# 15630080 |
10 mM |
| Chemical compound or drug |
7-Aminoactinomycin D (7-AAD) |
BD |
Cat# 559925 |
|
| Chemical compound or drug |
Paraformaldehyde |
Thermo Fisher |
Cat# J61899.AK |
|
| Chemical compound or drug |
Rat serum |
STEMCELL Technologies |
Cat# 13551 |
|
| Chemical compound or drug |
16% formaldehyde (w/v), methanol-free |
Thermo Fisher |
Cat# 28906 |
1% |
| Chemical compound or drug |
Glycine |
Fisher |
Cat# 50-751-6880 |
125 mM |
| Chemical compound or drug |
EDTA |
Fisher |
Cat# BP120-500 |
|
| Chemical compound or drug |
Glycerol |
Fisher |
Cat# BP229-1 |
|
| Chemical compound or drug |
Triton X-100 |
MilliporeSigma |
Cat# T8787 |
|
| Chemical compound or drug |
Tris–HCl |
MilliporeSigma |
Cat# T3253 |
|
| Chemical compound or drug |
Sodium dodecyl sulfate (SDS) |
Fisher |
Cat# BP166-500 |
|
| Chemical compound or drug |
Protein A dynabeads |
Thermo Fisher |
Cat# 10013D |
|
| Chemical compound or drug |
Sodium bicarbonate |
MilliporeSigma |
Cat# S5761 |
|
| Chemical compound or drug |
Tamoxifen |
MilliporeSigma |
Cat# 10540-29-1 |
2 mg per mouse in corn oil |
| Commercial assay or kit |
eBioscience Fixable Viability Dye eFluor 780 |
eBioscience |
Cat# 65-0865-14 |
FACS (1:1000) |
| Commercial assay or kit |
CellROX Deep Red Flow Cytometry Assay Kit |
Thermo Scientific |
Cat# C10491
|
|
| Commercial assay or kit |
Biotin Annexin V |
Stem Cell Technology |
Cat# 17899C |
FACS (1:200) |
| Commercial assay or kit |
APC Streptavidin |
BioLegend |
Cat# 405207 |
FACS (1:200) |
| Commercial assay or kit |
Mouse IgE ELISA MAX Capture Antibody |
BioLegend |
Cat# 79122 |
ELISA (1:200) |
| Commercial assay or kit |
Mouse IgE ELISA MAX Detection Antibody |
BioLegend |
Cat# 79123 |
ELISA (1:200) |
| Commercial assay or kit |
Avdin-HRP |
BioLegend |
Cat# 79004 |
ELISA (1:5000) |
| Commercial assay or kit |
Mouse IgE Standard |
BioLegend |
Cat# 401801 |
ELISA (1:200) |
| Commercial assay or kit |
EpiJET Bisulfite Conversion Kit |
Thermo Scientific |
Cat# K1461 |
|
| Commercial assay or kit |
PyroMark PCR Kit |
QIAGEN |
Cat# 978703 |
|
| Commercial assay or kit |
Ligation Sequencing Kit |
Nanopore |
Cat# SQK-LSK110 |
|
| Commercial assay or kit |
Native Barcoding Expansion 1–12 (PCR-free) |
Nanopore |
Cat# EXP-NBD104 |
|
| Commercial assay or kit |
Flongle Flow Cell (R9.4.1) |
Nanopore |
Cat# FLO-FLG001 |
|
| Commercial assay or kit |
EasySep Mouse B Cell Isolation Kit |
STEMCELL Technologies |
Cat# 19854A |
|
| Commercial assay or kit |
EasySep Human Naïve B Cell Isolation Kit |
STEMCELL Technologies |
Cat# 17254 |
|
| Commercial assay or kit |
MethylCode Bisulfite Conversion Kit |
Thermo Fisher |
Cat# MECOV50 |
|
| Commercial assay or kit |
RNeasy Kit |
QIAGEN |
Cat# 74004 |
|
| Commercial assay or kit |
D1000 Screen Tape |
Agilent |
Cat# 5067-5582 |
|
| Commercial assay or kit |
D1000 Sample Buffer |
Agilent |
Cat# 5067-5583 |
|
| Commercial assay or kit |
D1000 Ladder |
Agilent |
Cat# 5067-5586 |
|
| Commercial assay or kit |
RNA Screen Tape |
Agilent |
Cat# 5067-5576 |
|
| Commercial assay or kit |
RNA Screentape Sample Buffer |
Agilent |
Cat# 5067-5577 |
|
| Commercial assay or kit |
NEBNext Poly(A) mRNA Magnetic Isolation Module |
NEB |
Cat# E7490 |
|
| Commercial assay or kit |
NEBNext Ultra II Directional RNA Library Prep Kit |
NEB |
Cat# E7760L |
|
| Commercial assay or kit |
NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set) |
NEB |
Cat# E7600S, E7780S |
|
| Commercial assay or kit |
DNA Clean & Concentrator-5 |
Zymo Research |
Cat# NC9552153 |
|
| Commercial assay or kit |
2X SYBR Select Master Mix for CFX |
Applied Biosystems |
Cat# 4472942 |
|
| Gene (M. musculus) |
Prdm1
|
MGI:99655; NCBI Gene: 12142 |
|
|
| Genetic reagent (M. musculus) |
IgHCGG |
Dr. Gabriel Victora |
PMID:30181412 |
|
| Genetic reagent (M. musculus) |
Tet2
fl/fl
Tet3
fl/fl
|
Dr. Anjana Rao |
N/A |
|
| Genetic reagent (M. musculus) |
Rosa26
LSL-EYFP
|
The Jackson Laboratory |
Cat# 006148 |
|
| Genetic reagent (M. musculus) |
Ubc-CreERT2
|
The Jackson Laboratory |
Cat# 008085 |
|
| Genetic reagent (M. musculus) |
C57BL/6J |
The Jackson Laboratory |
Cat# 000664 |
|
| Peptide, recombinant protein |
Recombinant human interleukin-21 (rhIL-21) |
PeproTech |
Cat# 200-21 |
100 ng/mL |
| Peptide, recombinant protein |
Mouse IgM Standard |
SouthernBiotech |
Cat# 5300-01B |
ELISA (1:100) |
| Peptide, recombinant protein |
Mouse IgG1 Standard |
SouthernBiotech |
Cat# 5300-01B |
ELISA (1:10000) |
| Peptide, recombinant protein |
NEBNext Ultra II End Repair/dA-Tailing |
NEB |
Cat# E7546L |
|
| Peptide, recombinant protein |
NEB Blunt/TA Ligase Master Mix |
NEB |
Cat# M0367 |
|
| Peptide, recombinant protein |
Recombinant murine interleukin-4 (rmIL-4) |
PeproTech |
Cat# 214-14 |
40LB-B: 1 ng/mL; LPS: 10 ng/mL |
| Peptide, recombinant protein |
Recombinant murine interleukin-21 (rmIL-21) |
PeproTech |
Cat# 210-21 |
40LB-B: 10 ng/mL |
| Peptide, recombinant protein |
Ascorbate oxidase, Cucurbita sp. (1000 U) |
MilliporeSigma |
Cat# 189724 |
0.1 U |
| Peptide, recombinant protein |
Recombinant murine IFN-γ (rmIFN-γ) |
PeproTech |
Cat# 315-05 |
10 U/mL |
| Peptide, recombinant protein |
Recombinant human interleukin-2 (rhIL-2) |
NIH |
N/A |
50 U/mL |
| Peptide, recombinant protein |
Recombinant human interleukin-10 (rhIL-10) |
PeproTech |
Cat# 200-10 |
12.5 ng/mL |
| Peptide, recombinant protein |
Recombinant human interleukin-4 (rhIL-4) |
PeproTech |
Cat# 200-04 |
5 ng/mL |
| Peptide, recombinant protein |
RNase A |
Thermo Fisher |
Cat# R1253 |
|
| Peptide, recombinant protein |
Proteinase K |
QIAGEN |
Cat# 19131 |
0.5 mg/mL |
| Peptide, recombinant protein |
Trypsin-EDTA (0.05%), phenol red |
Thermo Fisher |
Cat# 25300120 |
|
| Sequence-based reagent |
CpG 1080 (phosphorothioate backbone) |
TriLink |
N/A |
1 µg/mL; TGACTGTGAACGTTCGAGATGA
|
| Sequence-based reagent |
Prdm1-Pro-BS-F1 |
IDT |
Bisulfite PCR primers |
AGAGAAGATTTAATATTTGAGATAAGTT
|
| Sequence-based reagent |
Prdm1-Pro-BS-R1 |
IDT |
Bisulfite PCR primers |
CAATCCTTATTAAAATCCATTTACAAAC
|
| Sequence-based reagent |
Prdm1-E27-BS-F1 |
IDT |
Bisulfite PCR primers |
GTGTGTATTTGAGTGTTTTTTTTAATAT
|
| Sequence-based reagent |
Prdm1-E27-BS-R1 |
IDT |
Bisulfite PCR primers |
CTAACCTCAAATCCTATCTATATTAACA
|
| Sequence-based reagent |
Prdm1-E27-BS-F2 |
IDT |
Bisulfite PCR primers |
AATATAGATAGGATTTGAGGTTAGGTTA
|
| Sequence-based reagent |
Prdm1-E27-BS-R2 |
IDT |
Bisulfite PCR primers |
TATAACAAAAAAACTAACCTAAACAACC
|
| Sequence-based reagent |
Prdm1-E27-BS-F3 |
IDT |
Bisulfite PCR primers |
GTAAAATGGTTTATATTATTTGTGTTGG
|
| Sequence-based reagent |
Prdm1-E27-BS-R3 |
IDT |
Bisulfite PCR primers |
AAAAAAAATTAAAACCAAAACAAAAACT
|
| Sequence-based reagent |
Prdm1-E58-BS-F1 |
IDT |
Bisulfite PCR primers |
GTAGGTTTTTTTTGTTTGTTTAGTATTA
|
| Sequence-based reagent |
Prdm1-E58-BS-R1 |
IDT |
Bisulfite PCR primers |
CCTTAATCACTAACTCAATATAAAACAA
|
| Sequence-based reagent |
Prdm1-E58-BS-F2 |
IDT |
Bisulfite PCR primers |
TTTATATTGAGTTAGTGATTAAGGTGAA
|
| Sequence-based reagent |
Prdm1-E58-BS-R2 |
IDT |
Bisulfite PCR primers |
CCTTAAAAACCTTATATAAACCCATAAC
|
| Sequence-based reagent |
Prdm1-E58-BS-F3 |
IDT |
Bisulfite PCR primers |
ATAAGAGATAGTTTATGGTTTTAAGGAG
|
| Sequence-based reagent |
Prdm1-E58-BS-R3 |
IDT |
Bisulfite PCR primers |
AAACTAAACTATCACTATCTAACTAACA
|
| Sequence-based reagent |
Prdm1-E58-BS-F4 |
IDT |
Bisulfite PCR primers |
TTTTGTGTGATTTTTTAGATAAGTAAGT
|
| Sequence-based reagent |
Prdm1-E58-BS-R4 |
IDT |
Bisulfite PCR primers |
ACTCTACCTATAATACTAAACAAACAAA
|
| Sequence-based reagent |
Cd4-Ch-F |
IDT |
ChIP-qPCR primers |
CCCATAGGGAAACAGCAAGA
|
| Sequence-based reagent |
Cd4-Ch-R |
IDT |
ChIP-qPCR primers |
CCCACTCAATCTCCAGCAAT
|
| Sequence-based reagent |
Prdm1-E27-Ch-F |
IDT |
ChIP-qPCR primers |
CAGTGCAGCAGTGGAGGTTA
|
| Sequence-based reagent |
Prdm1-E27-Ch-R |
IDT |
ChIP-qPCR primers |
AACCGTTGAAAGACGGTGAC
|
| Software, algorithm |
FlowJo V10 |
TreeStar |
RRID:SCR_008520
|
Flow data processing and analysis |
| Software, algorithm |
GraphPad Prism V8 |
GraphPad |
RRID:SCR_002798
|
Graphs and statistical analysis |
