TABLE 4.
Flagellar promoter structure
Gene | Promoter regionsa |
---|---|
Potential ς28-dependent promoters | |
flaA | CTAAAG gatatgcatacgtc GCCGTTAA agggact G |
flaB | CTAAAG aaatcaggttgagc GCCGTTAA taaaagt A |
flaD | CTAAAG cttctgaatttggt GTCGTTAA tagaagt AA |
motX | CTAAAG cttagctgcagatt GCCGATAA gtttatc A |
motAb | CTAAAA aaatctgttctagtt GTCGATAC aagtaat A |
cheV | CTAAAc atactgagcaaaat GCCGATAG acttagc G |
flgMb | tTAAAG ttatcgtttggttg GTCGATAG tctggat A |
Consensus | CTAAAG n14 G(C/T)CG(A/T)TAA n7 +1 |
Potential ς54-dependent promoters | |
motY | TGGC gggattt TTGC atgacaatcgtt G |
flgB (P1)c | TGGC ttgctta TTGC agtctaaaacgtc A |
flgB (P2) | TGGC acgctaa TTGC tatttagttatt A |
flgK | TGGC acatctt TTGC tttcacttgtcta G |
flhAb | aGGC gaaatgg TcGC gtataaacatt A |
fliE | TGGC acataaa TTGC tgtgtcaatattt A |
Consensus | TGGC n7 TTGC n11-13 +1 |
Other promoters, flaC | tttagcaagtaatttttacggtcagtgcttatccaa A |
Defined by primer extension analysis. Underlined, capitalized nucleotide designates +1 with respect to transcription. Uppercase letters indicate residues conserved among polar flagellar promoters or with respect to consensus promoters.
Faint ladders of primer extension products suggest that the gene may also be transcribed as part of a larger transcriptional unit initiating from the promoter of an upstream gene.
Two primer extension products, labeled P1 and P2, resulted for the flgB promoter. P1 and P2 are separated by 62 bp.