TABLE 4.
Flagellar promoter structure
| Gene | Promoter regionsa |
|---|---|
| Potential ς28-dependent promoters | |
| flaA | CTAAAG gatatgcatacgtc GCCGTTAA agggact G |
| flaB | CTAAAG aaatcaggttgagc GCCGTTAA taaaagt A |
| flaD | CTAAAG cttctgaatttggt GTCGTTAA tagaagt AA |
| motX | CTAAAG cttagctgcagatt GCCGATAA gtttatc A |
| motAb | CTAAAA aaatctgttctagtt GTCGATAC aagtaat A |
| cheV | CTAAAc atactgagcaaaat GCCGATAG acttagc G |
| flgMb | tTAAAG ttatcgtttggttg GTCGATAG tctggat A |
| Consensus | CTAAAG n14 G(C/T)CG(A/T)TAA n7 +1 |
| Potential ς54-dependent promoters | |
| motY | TGGC gggattt TTGC atgacaatcgtt G |
| flgB (P1)c | TGGC ttgctta TTGC agtctaaaacgtc A |
| flgB (P2) | TGGC acgctaa TTGC tatttagttatt A |
| flgK | TGGC acatctt TTGC tttcacttgtcta G |
| flhAb | aGGC gaaatgg TcGC gtataaacatt A |
| fliE | TGGC acataaa TTGC tgtgtcaatattt A |
| Consensus | TGGC n7 TTGC n11-13 +1 |
| Other promoters, flaC | tttagcaagtaatttttacggtcagtgcttatccaa A |
a
Defined by primer extension analysis. Underlined, capitalized nucleotide designates +1 with respect to transcription. Uppercase letters indicate residues conserved among polar flagellar promoters or with respect to consensus promoters.
b
Faint ladders of primer extension products suggest that the gene may also be transcribed as part of a larger transcriptional unit initiating from the promoter of an upstream gene.
c
Two primer extension products, labeled P1 and P2, resulted for the flgB promoter. P1 and P2 are separated by 62 bp.