| Gene Symbols | Forward | Reverse |
| IFIT2 | gacacggttaaagtgtggagg | tccagacggtagcttgctatt |
| IFIT1 | tgagatgtcactttacatggg | tgtattcccacactgtatttgg |
| CCP110 | agacgcagtctgagaggtagt | cagtgtttgcctgtcaactgg |
| CEP152 | ggagtggcagtctaagctgg | tcactggtggttacttggtca |
| NDUFB11 | cgtccgctgggaatctagc | acggggtccttgtcataacca |
| COX5B | tgtgaagaggacaataccagcg | ccagcttgtaatgggctccac |
| COX6B1 | ctacaagaccgccccttttga | tttagcggtcattgccttctg |
| SRSF11 | caggtgactaatgtctccccg | gcagttcgtcgatcttgcct |
| PNN | gaatgacgtgaggcccatcca | ctctgtttggctgggggtcct |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.