Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Danio rerio) | Tübingen | ZIRC | http://zfin.org/ZDB-GENO-990623-3 | See methods, animals |
| Genetic reagent (Danio rerio) |
Tg(myo6b:GCaMP6s-CAAX)idc1; GCaMP6CAAX; |
Jiang et al., 2017 | https://zfin.org/ZDB-ALT-170113-3 | Membrane-localized calcium biosensor |
| Genetic reagent (Danio rerio) | Tg(myo6b:mitoGCaMP3)w119Tg; MitoGCaMP3; | Esterberg et al., 2014 | https://zfin.org/ZDB-ALT-141008-1 | Mitochondria-localized calcium biosensor |
| Genetic reagent (Danio rerio) | Tg(myo6b:mitoTimer)w208Tg; MitoTimer | Pickett et al., 2018 | https://zfin.org/ZDB-ALT-190708-1 | Mitochondria-localized ROS biosensor |
| Genetic reagent (Danio rerio) |
Tg(myo6b:SypHy)idc6Tg; SypHy |
Zhang et al., 2018 | https://zfin.org/ZDB-ALT-171205-5 | Hair-cell localized vesicle fusion indicator |
| Genetic reagent (Danio rerio) | cav1.3atn004 mutants; gemini; cacna1da | Sidi et al., 2004 | https://zfin.org/ZDB-GENE-030616-135 | Mutants lacking functional Cav1.3 channels |
| Genetic reagent (Danio rerio) | otofb | This paper | https://zfin.org/ZDB-ALT-211124-4 | Crispr-Cas9 mutant. See Materials and Methods, “Animals” |
| Genetic reagent (Danio rerio) | otofa | This paper | https://zfin.org/ZDB-ALT-211124-3 | Crispr-Cas9 mutant. See Materials and Methods, “Animals” |
| Sequence-based reagent | otofa guide | This paper | PCR primers | 5’- GGGCACCTTCAAACTAGACG(TGG)–3’, made by IDT |
| Sequence-based reagent | otofb guide | This paper | PCR primers | 5’-GGAGCTCCACTGAGGTGCAGG(TGG)–3’, made by IDT |
| Sequence-based reagent | OTOFA FWD | This paper | PCR primers | 5’-ATCAAACCTCCATTGGAAACAG-3’, made by Integrated DNA Technologies (IDT) |
| Sequence-based reagent | OTOFA REV | This paper | PCR primers | 5’-CCCATTTGTGATGAAACTGATG-3’, made by IDT |
| Sequence-based reagent | OTOFB FWD | This paper | PCR primers | 5’- CTGGTTCATTCGTAGGCTTTCT-3’, made by IDT |
| Sequence-based reagent | OTOFB REV | This paper | PCR primers | 5’-TGCTTACATCAGAGATGTTGGG-3’, made by IDT |
| Antibody | Otoferlin (mouse monoclonal) |
Developmental Studies Hybridoma Bank | RRID:AB_10804296 HCS-1 |
Use at 1:1000 |
| Antibody | Alexa Fluor 488 (goat polyclonal) |
ThermoFisher | A-11001 | Use at 1:1000 |
| Other | Prolong Gold | ThermoFisher | P10144 | See methods, immunohistochemistry |
| Peptide, recombinant protein | α-bungarotoxin | Tocris | 2133 | See methods, paralysis and immobilization |
| Chemical compound, drug | Isradipine; Israd |
Sigma-Aldrich | I6658 | See methods, cell-death assays |
| Chemical compound, drug | Tricaine; MESAB | Sigma-Aldrich | A5040 | See methods, paralysis and immobilization |
| Chemical compound, drug | Dynole 34–2 | Tocris Biosciences | 4222 | See methods, cell-death assays |
| Chemical compound, drug | Neomycin; Neo |
Sigma-Aldrich | N1142 | See methods, cell-death assays |
| Chemical compound, drug | Gentamicin; Gent |
Sigma-Aldrich | G1272 | See methods, cell-death assays |
| Other | FM 4–64 | ThermoFisher | T3166 | See methods, cell-death assays |
| Other | Texas Red-x-succinimidyl ester | ThermoFisher | T20175 | See methods, Neomycin-Texas Red uptake |
| Other | CellROX Orange | ThermoFisher | C10444 | See methods, live imaging |
| Other | MitoSOX Red | ThermoFisher | M36008 | See methods, live imaging |
| Other | TMRE | ThermoFisher | T669 | See methods, live imaging |
| Other | DAPI | ThermoFisher | D1306 | See methods, live imaging |
| Software, algorithm | Prism (v. 8) | Graphpad Software | RRID:SCR_002798; https://www.graphpad.com | See methods, statistics |
| Software, algorithm | Adobe Illustrator | Adobe | RRID:SCR_014198; https://www.adobe.com | See figures |
| Software, algorithm | FIJI is just ImageJ | NIH | RRID:SCR_003070; https://fiji.sc | See methods, image analysis |
| Software, algorithm | PolyPeak Parser | Hill et al., 2014 | http://yosttools.genetics.utah.edu/PolyPeakParser/ | See methods, animals |
| Software, algorithm | Zen | Zeiss | RRID:SCR_01367; https://www.zeiss.com/microscopy/int/products/microscope-software/zen.html | See methods, immunohistochemistry |
| Software, algorithm | Prairie View | Bruker Corporation | RRID:SCR_017142; https://www.bruker.com/products/fluorescence-microscopes/ultima-multiphoton-microscopy/ultima-in-vitro/overview.html | See methods, functional imaging |
| Software, algorithm | G*Power | Faul et al., 2009 | RRID:SCR_013726; https://doi.org/10.3758/BRM.41.4.1149 http://www.gpower.hhu.de/ | See methods, statistics |
| Software, algorithm | Igor Pro | Wavemetrics | RRID:SCR_000325; http://www.wavemetrics.com/products/igorpro/igorpro.htm | See methods, electrophysiology |
| Software, algorithm | pClamp 10 | Molecular Devices | RRID:SCR_011323; http://www.moleculardevices.com/products/software/pclamp.html | See methods, electrophysiology |