Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Prediction of Optimal Secondary structure of the has-miR-942 (EPS format) with -56.70 kcal/mol with its dot-bracket notation using the Rfold web server. The sequence of this microRNA: ATTAGGAGAG TATCTTCTCTGTTTTGGCCA TGTGTGT ACTCACAGCC CCTCACACATGGCCGAAACAGAGAAGTTACTTTCCTAAT
