TABLE 2.
Oligonucleotide primers
Primer | Sequence (5′–3′)b | Location or description |
---|---|---|
dam-F | YRAARTGGRCWGGKGGHAARa | Degenerate primer |
dam-R | CGDCCRWAYGGHACRTTRAAa | Degenerate primer |
dam-in1 | TTTCCCCCTGCTCTGCAATT | purH region near BamHI site |
dam-in2 | CAGTGGGTATGGCCTTAGAA | ssuMB region |
purH3′ | CAGCTGCAGGTATCAAGGCTAT | 3′ end of purH gene |
ssuMB3′ | CACATCTGGATACTTGTCAC | 5′ end of ssuRA gene |
ssuRA5′Ec | GGAATTCGCTTCAACTCAAGAAGGAGA | 3′ end of ssuMB gene with EcoRI site |
ssuRA3′Pst | AACTGCAGGTAATCTGGCGTTCGATTAG | 5′ end of ssuRB gene with PstI site |
ssuRB5′Ec | GGAATTCTGGTGAAGGTTGGCAAAGGT | 3′ end of ssuRA gene with EcoRI site |
ssuRB3′Pst | AACTGCAGCCTGCTCAGACTCTAACAAC | 5′ end of purD gene with PstI site |
ssuRB3′ | CCTGCTCAGACTCTAACAAC | 5′ end of purD |
Y, C or T; R, A or G; W, A or T; K, G or T; H, A or C or T; D, A or G or T.
Unique restriction cleavage sites introduced in the oligonucleotides are underlined.