TABLE 1.
mtDNA regions, sizes, positions in complete C. albicans mtDNA sequence, and primers
| Region | Length of consensus sequence (bp)a | Positions in complete mtDNA sequence | Primers flanking the sequenced region |
|---|---|---|---|
| 1 | 373 | 4939–4567 | GAGCGGTTGATCTAATACCACCb |
| TCTTCTATCGTGCATATGCTCCb | |||
| 2 | 440 | 1507–1068 | ACGCCAATTATACGTCAAGG |
| GAACGTGTAACAACACACTAATCG | |||
| 3 | 352 | 35511–35160 (10449–10800)c | GGTGATATAGTAGGGATACCTACTGG |
| TAGGTAACCTGGGAATGTCG | |||
| 4 | 201 | 30934–30734 | TTATGGTCTTAGCGATTGGTAT |
| TATGACCCTATGAGGCTTTATTb | |||
| 5 | 493 | 24219–23728 | AGAAGAATGAGGCACCATTAGC |
| CACACGATAAGGATAGACGTGG | |||
| 6 | 325 | 21399–21079 | ATGTGCATCATTGGATAGGAGG |
| ACTATTGGTGCGTTACCTGG | |||
| 7 | 369 | 16332–15991 | GTGCACTAATTGATGATAGAGGTGG |
| CCATTACATTAAATGCTCTAACGCGb |
The consensus sequences for regions 5, 6, and 7 are larger than those for the corresponding regions in the complete mtDNA sequence (haplotype 1) due to gaps in haplotype 1 (see Fig. 1).
Perfect matches to the complete C. albicans mtDNA sequence would have been as follows (differences from the respective primers are underlined): region 1, GAGCGGTTGATCTAATACTACC and TCTTCTATAGTGAATATGCTCC; region 4, TATGACTATATGAGGCTTTATT; and region 7, CAATTATATTAAATGCTCTAAAGCG.
Region 3 is located within the inverted repeat in C. albicans mtDNA. No heterogeneity between copies of the repeat was detected in any of the haplotypes under sequencing conditions that routinely detect such heterogeneity in nuclear DNA regions heterozygous at specific nucleotide sites in C. albicans. Numbers in parentheses are the coordinates of region 3 in the alternate copy of the repeat.