TABLE 2.
List of primers used in this study
| Primer | Sequence (5′–3′) | Descriptiona |
|---|---|---|
| JL14 | AACGCCGGCAAAGGCGCGAACAGTTAAT | 5′ end of F62 lgtC; to make probe for lgtC |
| JL15 | GCCGTCTGAAGGCTTCAGACGGCCTGCC | 3′ end of F62 lgtC; to make probe for lgtC |
| JL50 | CTGAATTCGGCCGACATCGCGCTTTTGGGCG | 5′ of start codon of F62 lgtA, with EcoRI site |
| JL51 | ATGGATCCGGGGCGATTTTACCTAGCAGATGAA | 200 bp downstream of stop codon of F62 lgtE, with BamHI site |
| Got5220R | GAATGACAGTGGATCCATTTCTGATTTTA | 3′ end of F62 lgtE, with BamHI site; to clone pNS44lgtABE |
| DA5 | GCCGTAAACTTTCTCAAGCTCCGCCT | Close to the 3′ end of F62 lgtE; to clone pNS44lgtABΔE |
| DA3 | AACTGTTCGCGCCTTTGCCGGCG | 3′ end of F62 lgtB |
| 196-1040R | CCCGAGCTCAAAGGATAAAGGCAAAATGCC | 5′ end of 15253 lgtG, with SacI site; to clone pNS44lgtG and make probe for lgtG |
| lgtG-1240R | AATGAATTCTGAAAACCCGTTCAGACGGCA | 3′ end of 15253 lgtG, with EcoRI site; to clone pNS44lgtG |
| 196-1530F | TTTGAGAATTCCCCGTTAGCTTTTTGCCG | 3′ end of 15253 lgtG, with EcoRI site; to make probe for lgtG |
| rfaK-147F | AAGCCCGGGCGTATGTTTGGGCTTTTTTGC | 5′ end of F62 rfaK operon, with SmaI site; to make probe for lgtF and rfaK |
| rfaK-3780R | GTGAAGCTTATATTGCATCCAATAATTTGTCG | 3′ end of F62 rfaK operon, with HindIII site; to make probe for lgtF and rfaK |
| Uptake-A | GATCAGAATTCAGACGGCT | Primer for inserting uptake sequence into BamHI site of plasmids |
| Uptake-B | GATCAGCCGTCTGAATTCT | Primer for inserting uptake sequence into BamHI site of plasmids |
a
Description includes the gene the primer was used to amplify, the location of the primer relative to the coding sequence, and any restriction enzyme sites that are incorporated at the 5′ end which would facilitate the cloning of the resultant amplicon.