Table 1.
Primers and probes used in qmosRT-PCR assay for quantification of the nOPV2-c1 VP1-143T, VP1-171D, and VP1-295K mutants.
| Name of Oligos | Sequence 5′-->3′ | Tm (Basic) | Oligo Size | Amplicon Size (bp) |
|---|---|---|---|---|
| Oligonucleotides for detection of VP1-I143T nOPV2-c1 mutant variants | ||||
| Pr143s-2938F (forward) | GGAGTTCACTTTTGTGGTCACCTC | 56 | 24 | 74 |
| Pr143s-3011R (reverse) | TCTGATAAACTTGGTTCAATGCATGTCCGT | 59 | 30 | |
| Prb143Cs12 FAM (mutant probe) | FAM-ACTACACTGATG–MGBNFQ | 34 | 12 | |
| Prb143Aa13 VIC (non-mutant probe) | VIC-GCATCAATGTAGT–MGBNFQ | 36 | 13 | |
| Oligonucleotides for detection of N171D nOPV2-c1 mutant variants | ||||
| nOPV2c1_3021F (forward) | TACCACCCGGAGCACCTATC | 56 | 20 | 60 |
| nOPV2c1_3080R (reverse) | TAGAGGACGTCTGCCACGTA | 54 | 20 | |
| Prb171G-a12FAM (mutant probe) | FAM-TCATCCCATTTA-MGBNFQ | 36 | 12 | |
| Prb171T-12VIC (non-mutant probe) | VIC-TCATTCCATTTA-MGBNFQ | 30 | 12 | |
| Oligonucleotides for detection of E295K nOPV2-c1 mutant variants | ||||
| Sab2_3396R (reverse) | GTGTCCAAATCCATAAGTCG | 50 | 20 | 61 |
| Sab2_3336F (forward) | TTATAAAGATGGGCTCACCC | 50 | 20 | |
| PrbA11VIC (mutant probe) | VIC-TACCAAAAAAG-MGBNFQ | 28 | 11 | |
| Prb295Ca13FAM (non-mutant probe) | FAM-CCTTTTCTGGTAG-MGBNFQ | 38 | 13 | |