Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Custom primers designed to elucidate the physical genome molecule termini of the phage Mecenats66.
| Primer | Primer Sequence (5’–3’) | Coordinates in Mecenats66 Genome (Bases) |
|---|---|---|
| ph66_C_Fw | GCAGCAGGATCGTTAAGTCC | 85,939–85,958 |
| ph66_N_Rv | CTAGATCGCATCGATTGCAG | 334–353 |
