. 2022 Sep 10;10(9):1816. doi: 10.3390/microorganisms10091816

Table 1.

Primers used for qPCR analysis.

Strain	Sequence (5′–3′)	Products of the Targeted Genes	Annealing and Extension Temp. (°C)	Amplicon Size (bp)	Amplification Efficiency (%)	Correlation Coefficient (r²)	Reference
HI3	TAAACGAGGGAGTGCCCTTC	16S rRNA	60	160	88.2–92.6	0.994–0.999	This study
HI3	GTTAGCCCAGGCAGTCTTTCTA	16S rRNA	60	160	88.2–92.6	0.994–0.999	This study
MH1	ACGAAAACCCGTAGCCCAAC	16S rRNA	65	160	82.5–93.4	0.992–1.000	This study
MH1	TTCACACCCGACTTGTCACG	16S rRNA	65	160	82.5–93.4	0.992–1.000	This study
HB101	GCATCCATAGCAACAGACCCA	Thiamine-binding periplasmic protein	66	105	81.9–92.7	0.990–0.999	[30]
HB101	CGCCACAAAGCCTGAAAGAA	Thiamine-binding periplasmic protein	66	105	81.9–92.7	0.990–0.999	[30]