Table 1.
Reference and target genes and respective primers.
| Protein Name | Gene | Expression Condition | Primer Sequence (5′-3′) |
Amplicon Length (bp) |
Reference |
|---|---|---|---|---|---|
| Elongation factor 1-α | EF1α | Reference gene | FW: CGGTCACTTGATCTACAAGTGC RV: CCTCGAACTCACCAGTACCG |
302 | [35] |
| Putative exo-beta protein (PL3) | UCRNP2_317 | Up-regulated | FW: ATTCAGCACTCCGGTACCAC RV: GCCGTCCACGGACTTGAT |
255 | Present study |
| Putative aspartic endopeptidase PEP1 protein | UCRNP2_6229 | Up-regulated | FW: AGCTCCAGCTATGGTGGCTA RV: GACGATAGAGAAGCCGATGC |
172 | Present study |