Longitudinal characterization of circulating neutrophils uncovers phenotypes associated with severity in hospitalized COVID-19 patients

. 2022 Sep 26;3(10):100779. doi: 10.1016/j.xcrm.2022.100779

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies

Mouse Anti-Human IgG1-Fc PE	Southern Biotech	CAT# 9054-09; RRID: AB_2796628
Mouse Anti-Human IgG2-Fc PE	Southern Biotech	CAT# 9060-09; RRID: AB_2796635
Mouse Anti-Human IgG3-Fc PE	Southern Biotech	CAT# 9210-09; RRID: AB_2796701
Mouse Anti-Human IgM-Fc PE	Southern Biotech	CAT# 9020-09; RRID: AB_2796577
Mouse Anti-Human IgA1-Fc PE	Southern Biotech	CAT# 9130-09; RRID: AB_2796656
Pacific Blue(TM) anti-human CD66b antibody	Biolegend	CAT# 305112; RRID: AB_2563294
CD3 Pacific Blue	Biolegend	CAT# 317314; RRID: AB_571909
CD11b APC	Biolegend	CAT# 301310; RRID: AB_314162
CD14 APC/Cy7	Biolegend	CAT# 367108; RRID: AB_2566710
CD15 PE	Biolegend	CAT# 301905; RRID: AB_314197
CD16 PE	Biolegend	CAT# 302007; RRID: AB_314207
CD19 FITC	Biolegend	CAT# 302206; RRID: AB_314236
CD20 FITC	Biolegend	CAT# 302304; RRID: AB_314252
CD35 PE	Biolegend	CAT# 332404; RRID: AB_2890765
CD45 Alexa Fluor 700	Biolegend	CAT# 368514; RRID: AB_2566374
CD56 PE-Cy5	Biolegend	CAT# 318308; RRID: AB_604105
CD63 FITC	Biolegend	CAT# 353006; RRID: AB_10898319
CD66b APC	Biolegend	CAT# 305118; RRID: AB_2566607
Human TruStain FcX	Biolegend	CAT# 422302; RRID: AB_2818986
Rabbit anti-neutrophil elastase	Abcam	CAT# ab131260
Donkey anti-rabbit IgG (H+L) Alexa Fluor 488	Invitrogen	CAT# A21206; RRID: AB_2535792

Biological samples

Patient samples used in this study are detailed in Table S1	Massachusetts General Hospital	N/A
Healthy control blood samples	Stemexpress	CAT# PBEDT020F

Chemicals, peptides, and recombinant proteins

SARS-CoV-2 receptor binding domain (RBD)	Aaron Schmidt, Ragon Institute	N/A
SARS-CoV-2 nucleocapsid (N) protein	Aalto BioReagents	CAT# CK 6404-b
SARS-CoV-2 spike protein (S)	Eric Fischer, Dana Farber Cancer Institute	N/A
SARS-CoV-2 subunit 1 and 2 of the spike protein (S1 and S2)	Sino Biological	CAT#: 40591-V08B1; 40590-V08B
hCoV-OC43 RBD	Aaron Schmidt, Ragon Institute	N/A
hCoV-OC43 spike protein (S)	Sino Biological	CAT#: 40607-V08H1
hCoV-HKU1 spike protein (S)	Immune Tech	CAT#: IT-002-025p
SARS-CoV-1, MERS spike proteins (S)	Jason McLellan, University of Texas	N/A
HA A/Michigan/45/2015 (H1N1)	Immune Tech	IT-003-00105DTMp
HA A/Singapore/INFIMH-16-0019/2016 (H3N2)	Immune Tech	IT-003-00434DTMp
HA B/Phuket/3073/2013	Immune Tech	IT-003-B11DTMp
SYTOX™ Green Nucleic Acid Stain	Invitrogen	CAT# S7020

Critical commercial assays

EasySep™ Direct Human Neutrophil Isolation Kit	STEMCELL technologies	CAT# 19666
Qubit dsDNA High Sensitivity Assay Kit	Invitrogen	CAT# Q32854
High-Sensitivity DNA Bioanalyzer Kit	Agilent	CAT# 5067-4626
Nextera XT Library Prep kit	Illumina	CAT# FC-131-1024
LEGEND MAX™ Human Myeloperoxidase ELISA Kit (BioLegend, Cat#440007)	Biolegend	CAT# 440007
Citrullinated Histone H3 (Clone 11D3) ELISA Kit	Cayman Chemical	CAT# 501620

Deposited data

Neutrophil bulk RNAseq analyzed data	This paper	GEO: GSE212041 https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE212041
Olink COVID-19 plasma proteomic data	Olink	https://info.olink.com/mgh-covid-study-overview-page; https://doi.org/10.5281/zenodo.7076472
Somalogic COVID-19 plasma proteomic data	Filbin et al. 2021²³	Mendeley Data: https://doi.org/10.17632/nf853r8xsj; https://dx.doi.org/10.5281/zenodo.7076472
COVID-19 Neutrophil scRNA-Seq data	Schulte-Schrepping et al. 2020⁹	EGA: EGAS00001004571
Sepsis Neutrophil scRNA-seq data	Reyes et al. 2021⁴⁰	https://singlecell.broadinstitute.org/single_cell/study/SCP1492/
Dexamethasone COVID-19 Neutrophil scRNA-seq data	Sinha et al. 2021³⁶	GEO: GSE157789
BAL scRNA-Seq data	Bost et al. 2020⁵	GEO: GSE145926 and GSE149443
ARDS Neutrophil RNA-Seq	Juss et al. 2016⁴²	GEO: GSE76293
Human Protein Atlas Blood cell RNA-Seq	Uhlen et al. 2019⁹²	https://www.proteinatlas.org/download/rna_blood_cell.tsv.zip
Lung cancer single-cell neutrophil RNA-seq data	Zilionis et al. 2019⁴¹	GEO: GSE127465
BAL Neutrophil scRNA-seq data	Wendisch et al. 2021⁸³	EGA: EGAS00001004928 and EGAS00001005634

Oligonucleotides

RT primer (DNA oligo)	IDT	5′–AAGCAGTGGTATCAACGCAGAGTACT30VN-3′
TSO primer (RNA oligo with LNA)	Qiagen	5′-AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3′
ISPCR (DNA oligo)	IDT	5′-AAGCAGTGGTATCAACGCAGAGT-3′

Software and algorithms

Code and Data from this manuscript	This manuscript	https://doi.org/10.5281/zenodo.7030528; https://doi.org/10.5281/zenodo.7076472
IntelliCyt ForeCyt (v8.1)	Sartorius	https://intellicyt.com/products/software/
FlowJo (v10.7.1)	FlowJo, LLC	https://www.flowjo.com/solutions/flowjo
Prism 9.2.0 (283)	GraphPad	https://www.graphpad.com/scientific-software/prism/
GTEx-TOPMed RNA-Seq pipeline	Broad Institute	https://github.com/broadinstitute/gtex-pipeline/
STAR v2.5.3a	Dobin et al. 2013⁹³	https://github.com/alexdobin/STAR/releases/tag/2.5.3a
RSEM v1.3.0	Li et al. 2011⁹⁴	https://github.com/deweylab/RSEM/releases/tag/v1.3.0
RNA-SeQC 2	Graubert et al. 2021²⁴	https://github.com/getzlab/rnaseqc
CIBERSORTx	Newman et al. 2019³⁵	https://cibersortx.stanford.edu
DESeq2 v1.30.1	Love et al. 2014⁹⁵	https://bioconductor.org/packages/release/bioc/html/DESeq2.html
Fgsea	Korotkevich et al. 2016⁹⁶	http://bioconductor.org/packages/release/bioc/html/fgsea.html
Seurat v4.0.4	Hao and Hao et al. 2021⁹⁷	https://cran.r-project.org/web/packages/Seurat/index.html

Other

FluoSpheres™ NeutrAvidin™-Labeled Microspheres, 1.0 μm, yellow-green fluorescent (505/515), 1% solids	Invitrogen	CAT# F8776
MagPlex microspheres	Luminex corporation	CAT# MC12001-01
CaptureSelect IgA Affinity Matrix	ThermoScientific	CAT# 1942880005
Protein A/G Agarose	ThermoFisher	CAT# 20424
Luminol	Sigma-Aldrich	CAT# 123072