Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | BL21 star (DE3) | Thermo Fisher scientific | BL21 star (DE3) | Chemically competent cells |
| Strain, strain background (Escherichia coli) | BL21(DE3)-AI | Thermo Fisher scientific | BL21(DE3)-AI | Chemically competent cells |
| Strain, strain background (Escherichia coli) | Rosetta2 (DE3) | Novagen | Rosetta2 (DE3) | Chemically competent cells |
| Cell line (Spodoptera frugiperda) | Sf9 | Thermo Fisher Scientific | Cat. #11496015 | |
| Recombinant DNA reagent | pLM B042; pLM B043 (plasmid) | This paper | Holo-CstF | |
| Recombinant DNA reagent | pLM B092 (plasmid) |
This paper | MBP-CstF77 | |
| Recombinant DNA reagent | pLM B123 (plasmid) |
This paper | CstF77 | |
| Recombinant DNA reagent | pLM B142 (plasmid) |
This paper | PAP | |
| Recombinant DNA reagent | pLM B156 (plasmid) |
This paper | MBP-PAP | |
| Recombinant DNA reagent | pLM B157 (plasmid) |
This paper | GFP-PAP | |
| Recombinant DNA reagent | pLM B164 (plasmid) |
This paper | MBP-CstF7721–549 or MBP-CstF77 |
|
| Recombinant DNA reagent | pLM B168 (plasmid) |
This paper | MBP-CstF77mut | |
| Recombinant DNA reagent | pLM B170 (plasmid) |
This paper | CstF77mut | |
| Recombinant DNA reagent | pMC B051 (plasmid) |
This paper | CPSF30ZF4–ZF5 | |
| Recombinant DNA reagent | pMC B054 (plasmid) |
This paper | MBP-CPSF30ZF4–ZF5 | |
| Recombinant DNA reagent | pMC B055 (plasmid) |
This paper | CPSF30 ZF4 mutant | |
| Recombinant DNA reagent | pMC B056 (plasmid) |
This paper | CPSF30 ZF5 mutant | |
| Recombinant DNA reagent | pMC B057 (plasmid) |
This paper | CPSF30 ZF4 and ZF5 mutant | |
| Recombinant DNA reagent | pMC B058 (plasmid) |
This paper | CPSF30 ZF4 mutant | |
| Recombinant DNA reagent | pMC B059 (plasmid) |
This paper | CPSF30 ZF4 mutant | |
| Recombinant DNA reagent | pMC B060 (plasmid) |
This paper | CPSF30 ZF5 mutant | |
| Recombinant DNA reagent | pMC B061 (plasmid) |
This paper | CPSF30 ZF5 mutant | |
| Recombinant DNA reagent | pMC B062 (plasmid) |
This paper | CPSF30 ZF4 and ZF5 mutant | |
| Recombinant DNA reagent | pMC B063 (plasmid) |
This paper | CPSF30 ZF4 and ZF5 mutant | |
| Recombinant DNA reagent | pMC C011 (plasmid) |
This paper | hFip1CD | |
| Recombinant DNA reagent | pMC C015 (plasmid) |
This paper | GST-hFip1 fragment or hFip180–195 | |
| Recombinant DNA reagent | pMC C030 (plasmid) |
This paper | hFip1CD | |
| Recombinant DNA reagent | pMC C049 (plasmid) |
This paper | GFP-hFip1 | |
| Recombinant DNA reagent | pMC C050 (plasmid) |
This paper | GST-hFip1 fragment or hFip136–80 | |
| Recombinant DNA reagent | pMC C059 (plasmid) |
This paper | GST-hFip1 fragment, GST-hFip11–35, or hFip11–35 | |
| Recombinant DNA reagent | pMC C060 (plasmid) |
This paper | GST-hFip1 fragment, GST-hFip11–195, or hFip11–195 | |
| Recombinant DNA reagent | pMC C066 (plasmid) |
This paper | His6-GFP-TEV-hFip11–195 point mutant | |
| Recombinant DNA reagent | pMC C067 (plasmid) |
This paper | His6-GFP-TEV-hFip11–195 point mutant | |
| Recombinant DNA reagent | pMC C068 (plasmid) |
This paper | His6-GFP-TEV-hFip11–195 point mutant | |
| Recombinant DNA reagent | pMC C073 (plasmid) |
This paper | GST-hFip1 fragment, GST-hFip136–195, or hFip136–195 | |
| Recombinant DNA reagent | pMC C093 (plasmid) |
This paper | mutant GST-hFip11–35 | |
| Recombinant DNA reagent | pMC C094 (plasmid) |
This paper | mutant GST-hFip11–35 | |
| Recombinant DNA reagent | pMC C096 (plasmid) |
This paper | mutant GST-hFip11–35 | |
| Recombinant DNA reagent | pMC N015 (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018 (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018A (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018C-2 (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018G (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018G-0 (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018G-8 (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018G-10 (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018G-12 (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018G-14 (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018G-15 (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018G-21 (plasmid) |
This paper | FLAG-epitope-tagged mPSF | |
| Recombinant DNA reagent | pMC N018G-22 (plasmid) |
This paper | FLAG-epitope-tagged mPSF | |
| Recombinant DNA reagent | pMC N018G-23 (plasmid) |
This paper | FLAG-epitope-tagged mPSF | |
| Recombinant DNA reagent | pMC N018G-24 (plasmid) |
This paper | FLAG-epitope-tagged mPSF | |
| Recombinant DNA reagent | pMC N018H (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018I (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018J (plasmid) |
This paper | mPSF | |
| Recombinant DNA reagent | pMC N018K (plasmid) |
This paper | mPSF | |
| Sequence-based reagent | rLM 011 | This paper | 27 nt RNA substrate based on SV40 pre-mRNA; CUGCAAUAAACAACUUAACAACAAAAA | |
| Sequence-based reagent | rLM 015 | This paper | 5′ Cy5-labeled 27 nt RNA substrate based on SV40 pre-mRNA; CUGCAAUAAACAACUUAACGUCAAAAA | |
| Sequence-based reagent | rLM 016 | This paper | 5′ Cy5-labeled 27 nt RNA substrate based on SV40 pre-mRNA; CUGCAGUACACAACUUAACGUCAAAAA | |
| Sequence-based reagent | rLM 031 | This paper | 5′ Cy5-labeled 38 nt RNA substrate based on adenoviral L3 pre-mRNA; ACUUUCAAUAAAGGCAAAUGUUUUUAUUUGUACAAAAA |