Table 1.

Details of PCR and primers for species-specific identification of piroplasmids

Parasites	Primers (5′ → 3′)	Amplicon size (bp)	Target DNA	Annealing Temp. (X)	References
Theileria annulata	Tctb1-actttggccgtaatgttaaac Tctb2-ctctggaccaactgtttgg	313	Cytochrome b	60 ºC	[37]
T. buffali/orientalis	878TO_F-atgttgtccaagagaacgttca 878TO_R-tcgataatatgtgagactcagtgc	878	MPSP	55 ºC	Present study*
Babesia bigemina	MRCF-cgcttgcctcattatcgcac MRCR-cctcccctcttgaaacgcat	462	Rap-1c	60 ºC	Present study*
T. equi	TEEMA1F-5′aagcagtccgaggagca3′ TEEMA1R-5′ctgggaaggtgctgttg3′	595	EMA1	58 ºC	Present study*
B. gibsoni	BgTRAP1-aagccaacatcaaggaaagc BgTRAP2-ttctggtatgcggcagtgta	679	TRAP	56 ºC	[11]
B. canis vogeli	BcvF-5′gtgaaccttatcacttaaagg3′ BcvF-5′caactcctccacgcaatcg3′	610	18S rRNA	56 ºC	[38]
T. lestoquardi	TLCybF-actttaagcatcatgttcaat TLCybR-ttctggaccaactgtataa	313	Cytochrome b	50 ºC	Present study*

^*The new oligonucleotide primers described here were designed from species-specific signature genes, and then selected the region which was highly specific for a particular parasite species based on nucleotide alignment and finally tested in Primer-BLAST (NCBI) where programme was set as Search mode: automatic, Database: nr, Exclusion: none, Organism: kept blank and Primer specific stringency kept default for Primer Pair Specificity Checking Parameters. Further the specificity of these primers was checked based on its reactivity to the samples microscopically positive for infection with targeted parasite species, sequencing and nBLAST analysis (NCBI, USA)