Table 1.
Details of PCR and primers for species-specific identification of piroplasmids
Parasites | Primers (5′ → 3′) | Amplicon size (bp) | Target DNA | Annealing Temp. (X) | References |
---|---|---|---|---|---|
Theileria annulata |
Tctb1-actttggccgtaatgttaaac Tctb2-ctctggaccaactgtttgg |
313 | Cytochrome b | 60 ºC | [37] |
T. buffali/orientalis |
878TO_F-atgttgtccaagagaacgttca 878TO_R-tcgataatatgtgagactcagtgc |
878 | MPSP | 55 ºC | Present study* |
Babesia bigemina |
MRCF-cgcttgcctcattatcgcac MRCR-cctcccctcttgaaacgcat |
462 | Rap-1c | 60 ºC | Present study* |
T. equi |
TEEMA1F-5′aagcagtccgaggagca3′ TEEMA1R-5′ctgggaaggtgctgttg3′ |
595 | EMA1 | 58 ºC | Present study* |
B. gibsoni |
BgTRAP1-aagccaacatcaaggaaagc BgTRAP2-ttctggtatgcggcagtgta |
679 | TRAP | 56 ºC | [11] |
B. canis vogeli |
BcvF-5′gtgaaccttatcacttaaagg3′ BcvF-5′caactcctccacgcaatcg3′ |
610 | 18S rRNA | 56 ºC | [38] |
T. lestoquardi |
TLCybF-actttaagcatcatgttcaat TLCybR-ttctggaccaactgtataa |
313 | Cytochrome b | 50 ºC | Present study* |
*The new oligonucleotide primers described here were designed from species-specific signature genes, and then selected the region which was highly specific for a particular parasite species based on nucleotide alignment and finally tested in Primer-BLAST (NCBI) where programme was set as Search mode: automatic, Database: nr, Exclusion: none, Organism: kept blank and Primer specific stringency kept default for Primer Pair Specificity Checking Parameters. Further the specificity of these primers was checked based on its reactivity to the samples microscopically positive for infection with targeted parasite species, sequencing and nBLAST analysis (NCBI, USA)