KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| MCL1 | Cell Signaling Technology | Cat#4572,RRID:AB_2281980 |
| MCL1 | Cell Signaling Technology | Cat# 39224,RRID:AB_2799149 |
| BCL2 | Cell Signaling Technology | Cat# 4223, RRID:AB_1903909 |
| BCL2 | Cell Signaling Technology | Cat# 15071,RRID:AB_2744528 |
| BRD4 | Cell Signaling Technology | Cat# 13440,RRID:AB_2687578 |
| Cleaved PARP | Cell Signaling Technology | Cat# 9541, RRID:AB_331426 |
| p-AKT(T308) | Cell Signaling Technology | Cat# 4056, RRID:AB_331163 |
| p-AKT (S473) | Cell Signaling Technology | Cat# 9271, RRID:AB_329825 |
| p-PKC | Cell Signaling Technology | Cat# 9375, RRID:AB_2284224 |
| P-MEK1/2 | Cell Signaling Technology | Cat# 9121, RRID:AB_331648 |
| p-GSK3 | Cell Signaling Technology | Cat# 9331, RRID:AB_329830 |
| p-HER2(T1248)/p-EGFR (Tyr1173) | Cell Signaling Technology | Cat# 2244, RRID:AB_331705 |
| p-P38 | Cell Signaling Technology | Cat# 4511, RRID:AB_2139682 |
| SCD | Cell Signaling Technology | Cat# 2794, RRID:AB_2183099 |
| BRD4 (IHC) | EMD Millipore. | Catalog No. ABE1391 |
| Anti-rabbit IgG, HRP-linked Antibody | Cell Signaling Technology | Cat# 7074, RRID:AB_2099233 |
| Anti-mouse IgG, HRP-linked | Cell Signaling Technology | Cat# 7076, RRID:AB_330924 |
| Cleaved Caspase-3 (Asp175) | Cell Signaling Technology | Cat# 9661, RRID:AB_2341188 |
| β-actin | Sigma-Aldrich | Cat# A5316, RRID:AB_476743 |
| hERBB2/Her2 AF488 | R and D Systems | Cat# FAB9589G, RRID:AB_2800468 |
| Ki67 | Abcam | Cat# ab15580, RRID:AB_443209 |
| V5-Tag (D3H8Q) | Cell signaling | Cat #13202, RRID:AB_2687461 |
| Chemicals, peptides, and recombinant proteins | ||
| Lipofectamine 2000 | Thermo Fisher Scientific | Cat#:11668027 |
| PrestoBlue Cell Viability Assay kit | Life Technologies | Cat#:A13261 |
| Cellbrite orange | Biotium | Cat#:30022 |
| Prolong gold antifade mountant with DAPI | ThermoFisher Scientific | Cat#:P36935 |
| APO-BRDU™ Kit | BD Pharmingen | Cat#:556405 |
| Membrane Fluidity Kit | abcam | Cat#:Ab189819 |
| RNeasy Plus Mini Kit | Qiagen | Cat#:74134 |
| DharmaFECT Duo Transfection Reagent (Dharmacon) | Horizon Discovery | Cat#:T-2010-03 |
| RNeasy Mini kit | QIAGEN | Cat#: 74104 |
| iScript™ cDNA Synthesis Kit | Bio-Rad | Cat#:1708890 |
| Universal SYBR Green Fast qPCR Mix | ABclonal, | Cat#: #RK21203 |
| R.T.U. Vectastain Universal Elite ABC kit Anti-mouse IgG/Rabbit IgG | Vector Laboratories | Cat#: K-7100 |
| DAB (diaminobenzidine) Peroxidase (HRP) Substrate Kit | Vector Laboratories | Cat#: SK-4100 |
| Mayer’s hematoxylin | Electron Microscopy Sciences. | Cat#: 26173-03 |
| JQ1 | Selleckchem | Cat#: S7110 |
| SCD-inhibitor | MedChemExpress | Cat#: A939572 |
| MCL1 inhibitor-S63845 | Chemietek | Cat#: CT-S63845 |
| EGFR inhibitor-Lapatinib | Selleckchem | Cat#: S2111 |
| AKT inhibitor- MK-2206 2HCl | Selleckchem | Cat#: S1078 |
| PKC inhibitor- Go 6983 | Selleckchem | Cat#: S2911 |
| P38 MAPK inhibitor- Doramapimod (BIRB 796) | Selleckchem | Cat#: S1574 |
| MEK inhibitor- Trametinib (GSK1120212) | Selleckchem | Cat#: S2673 |
| Dimyristoyl-sn-glycero-3-phosphocholine (DMPC) | Avanti Lipids | Cat#: 850345 |
| pegylated distearoyl-phosphatidyl ethanolamine (DSPE-PEG-2000) | Avanti Lipids | Cat#: 880128 |
| Deposited data | ||
| Gene expression changes occurring in response to treatment with JQ1 in breast cancer cell lines | This study | GEO: GSE209934 |
| Response and resistance to BET bromodomain inhibitors in triple negative breast cancer [ChIP-Seq] | Shu et al. (2016) | GEO: GSE63581 |
| Protein expression changes occurring in response to treatment with JQ1 in breast cancer cell lines | This study | https://tcpaportal.org/mclp/#/download |
| Gene expression and mRNA profiles in CCLE | CCLE | https://portals.broadinstitute.org/ccle/data/browseData?conversationPropagation=begin |
| mRNA and protein expression data in patients with breast cancer | TCGA |
https://www.cbioportal.org/study/summary?id=brca_tcga
https://www.cbioportal.org/study/summary?id=ov_tcga |
| Experimental models: Cell lines | ||
| BT474 | MD Anderson Cancer Center Cell Line Repository | N/A |
| BT20 | MD Anderson Cancer Center Cell Line Repository | N/A |
| HCC1954 | MD Anderson Cancer Center Cell Line Repository | N/A |
| HCC1937 | MD Anderson Cancer Center Cell Line Repository | N/A |
| HCC1419 | MD Anderson Cancer Center Cell Line Repository | N/A |
| HCC70 | MD Anderson Cancer Center Cell Line Repository | N/A |
| MDAMB468 | MD Anderson Cancer Center Cell Line Repository | N/A |
| MCF7 | MD Anderson Cancer Center Cell Line Repository | N/A |
| SKBR3 | MD Anderson Cancer Center Cell Line Repository | N/A |
| SKOV3 | MD Anderson Cancer Center Cell Line Repository | N/A |
| Experimental models: Organisms/strains | ||
| Nude athymic NCr female mice | Department of Experimental Radiation Oncology, MD Anderson Cancer Center | N/A |
| Oligonucleotides | ||
| SCD1 (NM_005063): Forward primer: CCTGGTTTCACTTGGAGCTGTG | Sigma | N/A |
| SCD1 (NM_005063):Reverse primer: TGTGGTGAAGTTGATGTGCCAGC | Sigma | N/A |
| GAPDH (NM_002046): Forward primer: GTCTCCTCTGACTTCAACAGCG | Sigma | N/A |
| GAPDH (NM_002046): Reverse primer: ACCACCCTGTTGCTGTAGCCAA | Sigma | N/A |
| Human MCL1 siRNA | Sigma Aldrich | SASI HS01-00162656, SASI HS01-00162657 |
| Human BRD4 siRNA | Sigma Aldrich | SASI_HS01_00037409, SASI_Hs01_00037410 |
| Non-targeting siRNA Universal Negative Control | Sigma Aldrich | SIC001 |
| Recombinant DNA | ||
| pcDNA3.1 | Invitrogene | V79020 |
| Software and algorithms | ||
| Prism | GraphPad Software | N/A |
| Microsoft Excel | Microsoft | N/A |
| ImageJ | Schneider et al. (2012) | https://imagej.nih.gov/ij/ |
| TargetScore | Wang et al. (2021). https://doi.org/10.1101/2021.04.14.439861 | https://hub.docker.com/repository/docker/cannin/targetscore |
| rtracklayer 1.52.0 | Lawrence et al. (2009). | https://bioconductor.org/packages/release/bioc/html/rtracklayer.html |
| Gviz 1.28.3 | Hahne and Ivanek (2016) | https://bioconductor.org/packages/release/bioc/html/Gviz.html |
| FACSDIV8.1 software | MDACC flow cytometry core facility | BD Biosciences (https://www.bdbiosciences.com/en-eu/products/software/instrument-software/bd-facsdiva-software) |