| Antibodies |
| MPC1, rabbit monoclonal |
Cell Signaling Technology |
Catalog no. 14462; RRID:AB_2773729 |
| MPC2, rabbit monoclonal |
Cell Signaling Technology |
Catalog no. 46141; RRID:AB_2799295 |
| VDAC, rabbit monoclonal |
Cell Signaling Technology |
Catalog no. 4866; RRID:AB_2272627 |
| GDH, rabbit monoclonal |
Cell Signaling Technology |
Catalog no. 12793; RRID:AB_2750880 |
| GPT2, rabbit polyclonal |
Sigma-Aldrich |
Catalog no. HPA051514; RRID:AB_2681516 |
| α-Tubulin, mouse monoclonal |
Cell Signaling Technology |
Catalog no. 3873; RRID:AB_1904178 |
|
|
|
| Bacterial and virus strains |
| pLKO.1 |
Addgene |
Catalog no. 8453 |
|
|
|
| Biological samples |
|
|
|
| Chemicals, peptides, and recombinant proteins |
|
d-[U-13C]glucose |
Cambridge Isotopes |
Catalog no. CLM-1396 |
|
l-[U-13C]glutamine |
Cambridge Isotopes |
Catalog no. CLM-1822 |
|
l-[α-15N]glutamine |
Cambridge Isotopes |
Catalog no. NLM-1016 |
| Lipofectamine 2000 transfection reagent |
Invitrogen |
Catalog no. 11668019 |
| Polybrene |
EMD Millipore |
Catalog no. TR-1003-G |
| UK-5099 |
Sigma-Aldrich |
Catalog no. PZ0160 |
| CB-839 |
Sigma-Aldrich |
Catalog no. 5337170001 |
| Dimethyl–α-KG |
Sigma-Aldrich |
Catalog no. 349631 |
| Ammonium chloride (NH4Cl) |
Sigma-Aldrich |
Catalog no. A9434 |
| Matrigel (growth factor reduced) |
Corning |
Catalog no. 356231 |
| Piericidin A |
Cayman Chemical |
Catalog no. 15379 |
| Aminooxyacetate (AOA) |
Sigma-Aldrich |
Catalog no. C13408
|
| Pyruvate |
Thermo Fisher Scientific |
Catalog no. 11360070 |
|
|
|
| Critical commercial assays |
| Pierce BCA Assay |
Thermo Fisher Scientific |
Catalog no. 23225 |
| 0.4% trypan blue solution |
Sigma-Aldrich |
Catalog no. T8154 |
| Deposited data |
| Experimental models: Cell lines |
| Human: HEK293T cell line |
ATCC |
Catalog no. CRL-11268; RRID:CVCL_1926 |
| Human: Pfeiffer cell line |
Caro et al. (13) |
RRID:CVCL_3326 |
| Human: Toledo cell line |
Caro et al. (13) |
RRID:CVCL_3611 |
| Human: OCI-Ly4 cell line |
Caro et al. (13) |
RRID:CVCL_8801 |
| Human: Karpas 422 cell line |
Caro et al. (13) |
RRID:CVCL_1325 |
| Human: U2932 cell line |
Caro et al. (13) |
RRID:CVCL_1896 |
| Human: OCI-Ly1 cell line |
Caro et al. (13) |
RRID:CVCL_1879 |
| Human: OCI-Ly7 cell line |
Caro et al. (13) |
RRID:CVCL_1881 |
| Human: SU-DHL-4 cell line |
Caro et al. (13) |
RRID:CVCL_0539 |
| Human: SU-DHL-6 cell line |
Caro et al. (13) |
RRID:CVCL_2206 |
| Human: HBL-1 cell line |
Caro et al. (13) |
RRID:CVCL_4213 |
| Recombinant DNA |
| pLKO.1 Scramble (Scramble shRNA) |
Addgene |
Catalog no. 8453 |
| Human shMPC2-1 |
Sigma-Aldrich |
Catalog no. NM_015415; TRCN0000121612 |
| Human shMPC2-2 |
Sigma-Aldrich |
Catalog no. NM_015415; TRCN0000278229 |
| Human shGDH-1 |
Sigma-Aldrich |
Catalog no. NM_005271; TRCN0000028600 |
| Human shGDH-2 |
Sigma-Aldrich |
Catalog no. NM_005271; TRCN0000028611 |
| Human shGPT2-1 |
Sigma-Aldrich |
Catalog no. NM_133443; TRCN0000035028 |
| Human shGPT2-2 |
Sigma-Aldrich |
Catalog no. NM_133443; TRCN0000035024 |
| CRISPR target sequences |
| MPC1: AGGTTTACTGGGTTAATTGA and TAGATGCGCTTTAGCAGTTG |
| MPC2: AGGGATCGTTGGCAGCCGGG and TGGGTTGGAGTCGTGCGTAA |
| Software and algorithms |
| Prism 9 |
|
|
| R Project for Statistical Computing |
R Core Team, 2020 |
RRID:SCR_001905 |
| pheatmap |
Kolde et al. (55) |
RRID:SCR_016418 |
| ggplot2 |
Wickham et al. (56) |
RRID:SCR_014601 |
| limma |
Ritchie et al. (57) |
RRID:SCR_010943 |
