Table 2.
Sequence report.
| Product number | Product name | Target sequence |
|---|---|---|
| lnc6201202025322 | ASO-h-SNORD15B_001 | GATCGATTTAGAGGCATTTG |
| stB0008362A | genOFFTM st-h-TRIM25_001 | GGGTCAACAGCAAGTTTGA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.