TABLE 1.
Bacterial strains, phage, and plasmids used in the study
| Strain, phage, or plasmid | Description | Source or reference |
|---|---|---|
| E. coli | ||
| ORN115 | thr-1 leuB thi-1 Δ(argF-lac)U169 xyl-7 ara-13 mtl-2 gal-6 rpsL tonA2 supE44 pilG1 λr Pil+ (does not exhibit phase variation of piliation) | 31 |
| ORN174 | thr leu proA2 lacY1 galK his argE rpsL supE mtl xyl recBC sbcB tetR (inserted ca. 200 bp 3′ of the end of fimH) Pil+ | 24 |
| ORN178 | ORN115 except tetR inserted ca. 200 bp 3′ of the end of fimH, Pil+ | 24 |
| ORN201 | thr-1 leuB thi-1 Δ(argF-lac)U169 xyl-7 ara-13 mtl-2 gal-6 rpsL tonA2 supE44 pilG1 λrrecA13 Δ(fimBEACDEFGH) | 9 |
| ORN207 | ORN174 except fimH304::kan | Linear transformation of ORN174 with EcoRI-digested pORN164a |
| ORN208b | ORN115 except fimH304::kan with adjacent tetR, Nalr | P1 transduction from ORN207 to ORN115 and selection of a nalidixic acid-resistant variant |
| ORN209 | ORN115 except fimH165 allele and adjacent tetR gene | This study |
| ORN210 | ORN115 except fimH166 allele and adjacent tetR gene | This study |
| Bacteriophage | ||
| P1 | vir | Laboratory collection |
| Plasmids | ||
| pBR322 | ColE1 Apr Tcr | 1 |
| pKAS32c | oriR6K oriT rpsL Apr | 28 |
| pORN163d | pBR322 fimH Apr | Insertion of a 2-kb PvuII fragment containing fimH from pORN127 (17) into BamHI-cleaved pBR322 |
| pORN307 | pSH2 ΔfimH Cmr | 8 |
| pORN164 | pORN304 fimH304::kan, has kan gene from Tn5 inserted in the XhoI site created as part of deletion in fimH304 | Kan cassette inserted into XhoI site of pORN304 (8) |
| pORN165 | pORN163 except fimH165 | This study |
| pORN166 | pORN163 except fimH166 | This study |
Linear transformation and P1 transduction have been previously described (21).
Strain ORN208 was used as the recipient in a mating and allelic exchange protocol (28) that introduced mutant fimH alleles into the chromosome, replacing the fimH insertion mutation.
Introduction of the fimH mutant alleles into the chromosome was accomplished by first subcloning each mutant fimH allele carried on the ca. 1.8–kb SalI-EcoRI fragment of pORN163 into SalI-EcoRI-digested pGEM11ZF (Promega) and then removing an EcoRI-XbaI fragment containing the fimH allele. (The new restriction endonuclease sites on the ends of the fimH alleles were contributed by the polylinker in pGEM11ZF.) EcoRI-XbaI fragments containing the fimH alleles were introduced into EcoRI-XbaI-cleaved pKAS32 and then introduced into the chromosome of strain ORN208 by allelic exchange (28). Refer to Fig. 1 for a diagram.
PCR-generated mutant fimH genes were obtained by amplification using primers 5′GGGTTATTGTCTCATGAGCG and 5′CCGATCATCGTCGCGCTCCA flanking EcoRI and SalI sites in pBR322. PCR amplicons were digested with EcoRI and SalI, and the SalI-EcoRI fragments were isolated and ligated into SalI-EcoRI-cleaved pBR322. This ligation mixture was introduced into strain LE392 (19) by electroporation (25). Following electroporation, electroporant colonies were harvested and the plasmid DNA was extracted (4) and introduced into strain ORN201 harboring pORN307, as described in the text.