Table 2.

Patents for diagnostic and detection of Candida auris

	Applicant Number/ Reference	Country	Year	Indication	Application	Method/Primers
1	WO2020114998 (A1) [26]	US	2020	To identify C. auris	Real time PCR assay to detect 5.8S/ITS2 gene in biological and non biological samples	SEQ ID NO 1: CAUROOl forward primer T G AGCGT GAT GT CTT CT C AC SEQ ID NO 2: CAUR003 forward primer GAGCGTGATGTCTTCTCACC SEQ ID NO 3: CAUR005 forward primer ACT G ATTT GG ATTTT A A A ACT A ACCC A A SEQ ID NO 4 CAUR007 forward primer AACT AACCCAACGTTAAGTT CAAC SEQ ID NO 5: CAUR002 reverse primer CCTGATTTGAGGCGACAACAA SEQ ID NO 6: CAUR004 reverse primer CGT CTGC A AGT CAT ACT ACGT A SEQ ID NO 7: CAUR006 reverse primer CGATGATTCACGTCTGCAAGTC SEQ ID NO 8: CAUR008 reverse primer CAACGCCACCGCGAA SEQ ID NO 9: CAUR101HQ6 probe CTTCGCGGTGGCGTTGCATTCACA SEQ ID NO 10: CAUR103HQ6 probe TT CGCGGT GGCGTTGCATT CACA SEQ ID NO 11: CAUR105HQ10 probe ACA ACGG AT CT CTT GGTTCT CGC AT CG ATG SEQ ID NO 12: CAUR107HQ8 probe CTCGCATCGATGAAGAACGCAGCGAAA
2	CN110951905 (A) [27]	China	2020	To identify C. auris	LAMP method to Identify C. auris	The primer set includes an outer primer, an inner primer and a loop primer, and the outer primer is SEQ ID NO: 1 to SEQ ID. NO: 2, the inner primers are SEQ ID NO: 3 to SEQ ID NO: 4, and the loop primers are SEQ ID NO: 5 to SEQ ID NO: 6 External primer Cau416-F3: 5'-CCATGCTAACCCTGAAACT-3' (SEQ ID NO: 1) Outer primer Cau416-B3: 5'-CGAAGATACCACAACAACC-3' (SEQ ID. NO: 2) Inner primer Cau416-FIP: 5’-GGCCTTGGAGATGACACCATTTTTGTCGCTTTTGGTGCTC-3’ SEQ ID NO: 3) 5’-CTCCTGTTGGTTTGGTTAAGGTCAGTTGCGTGCAGACGAAGG-3’ (SEQ ID NO: 4) loop primer Cau416-LF1: 5’-GCAAGCTCAGTAGCCTGGT-3’ (SEQ ID NO: 5) Loop primer Cau416-LB1-2: 5'-TTCCCATTTGCTCAAGAACACT-3' (SEQ ID NO: 6)
3	CN110408720 (A) [28]	China	2020	To identify C. auris and distinguish it from similar species	High-resolution-ratio melting curve	Upstream primer is 5'-CGTAGTATGACTTGCAGACG-3' Downstream primer is 5'-GCGGGTAGTCCTACCTGAT-3'
4	ES2763043 (A1); ES2763043 (B2) [29]	Spain	2020	To detect and/or quantify of C. auris	Biosensor	SEQ ID NO: 2 (5'-TTTTGGGGGGTACGCAAGGCGAATCTACCCGGGGGGTTTT-3 ') or the nucleotide sequence SEQ ID NO: 3 (5'-TTTCTGTGTGTC 3' -TTCTGTGTGTC) EQ ID NO: 2 and SEQ ID NO: 3 specifically recognizes the region 892,198 to 892,217 of chromosome 2 of C. auris DNA, and the region 1,056,775 to 1,056,787 of chromosome 3 of C. auris gene respectively These sequences are specific for C. auris and do not exist in other pathogenic organisms guaranteeing the specificity of the biosensor for C. auris
5	US2020291488 (A1) [30]	US	2020	To detect the presence of a C. auris in a biological or environmental sample	T2MR	5′-CTA CCT GAT TTG AGG CGA CAA CAA AAC-3′ (SEQ ID NO: 4) and the second probe includes the oligonucleotide sequence: 5′-CCG CGA AGA TTG GTG AGA AGA CAT-3′ (SEQ ID NO: 5)
6	US10870829 (B2); US2020270567 (A1) [31]	US	2020	To ident and differentiate C. auris from another Candida spp	Identification of C. auris based on the sensitivity to certain compounds	Medium based on the positive selection system: Growth at Quaternary Ammonium Compound at 37-38ºC; Medium based on the negative selection system: Growth of C. auris based on distinctive sensitive to tert-butyl-hydroperoxide
7	CN110551840 (A) [32]	China	2019	Rapid and accurate screening to detect C. auris	Nucleic acid reagent, kit, system, and method for detecting invasive fungi	Code probe sequence: C-au C-au-P ROX-tgtcgttattgttactactgactctgacggttc-BHQ2
8	CN112041441 (A) [33]	China	2020	To detect C. auris from a specimen	LAMP method	The primers (FIP, BIP, F3, B3) and loop primers (loop-B, loop-F) are based on the specific bases of C. auris suitable for the LAMP method: FIP: AGGCTACTGAGCTTGCTGGTGTAACCAAACCAACAGGAGAGG BIP: ACGGTTTCAGGGTTAGCATGGCTCAACAAAGTCGCTGGTACA F3: GGGAAAGGAACCCTGACCT B3: GGACACAGCATTCGAAGTGT Ring-B: CACATACTCGAACGGAGTC Ring-F: CATCTCGAAGGCCTCGGT
9	CN110804671 (A) [34]	China	2020	To identify C. auris	rDNA (ITS) target genes as biomarkers for C. auris	Upstream primer C. auris: 5’-TGATGTCTTCTCACCMATCTTC-3’ Downstream primer C. auris: 5’-TGAGGCGACACAAAACG-3’ TaqManProbe: 5'FAM-AATCTTCGCGGTGGCGTTGCATTCA-TAMRA 3'
10	JP2021122236A [35]	Japan	2021	To identify C. auris	Culture medium that enables a quick and convenient check for the presence of C. auris	Screening medium containing an enzyme substrate contains raffinose and xylose

US: United State, Loop-mediated isotherm amplification (LAMP), T2 magnetic resonance T2MR