KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-tyrosinated α-tubulin, rat monoclonal, clone YL1//2 | Accurate Chemical and Scientific | Cat# YSRTMCA77G |
| Anti-detyrosinated α-tubulin, rabbit monoclonal, clone RM444 | RevMAb Biosciences | Cat# 31–1335-00 |
| Anti-Δ2 α-tubulin, rabbit monoclonal, clone RM447 | RevMAb Biosciences | Cat# 31–1339-00 |
| Anti-α-tubulin, mouse monoclonal, clone DM1α | Millipore Sigma | Cat# 05–829 |
| Anti-α-tubulin conjugated with FITC, mouse monoclonal, clone DM1α | Sigma-Aldrich | Cat# F2168 |
| Anti-CLIP-170, rabbit polyclonal | Novus Biologicals | Cat# NBP1–85568 |
| Anti-CLIP-115, rabbit | Boster | Cat# A07287 |
| Anti-Kif13B, rabbit polyclonal | Sigma-Aldrich | Cat# HPA025023 |
| Anti-TBCB, mouse monoclonal, clone E-1 | Santa Crutz | Cat# sc-390783 |
| Anti-CEP350, rabbit polyclonal | Novus Biologicals | Cat# NB100–59810 |
| Anti-p150glued, mouse monoclonal | BD Transduction Laboratories | Cat# 610474 |
| Anti-TBCE, rabbit polyclonal | Sigma-Aldrich | Cat# SAB1408635 |
| Anti-CYLD, mouse monoclonal, clone 733 | Thermo Fisher | Cat# 43–7700 |
| Anti-EML2, rabbit polyclonal | Sigma-Aldrich | Cat# HPA012757 |
| Anti-EML2, rabbit polyclonal | Proteintech | Cat# 13529–1-AP |
| Anti-Dynamin 1L, rabbit polyclonal | Thermo Fisher | Cat# PA1–16987 |
| Anti-CK1 delta, goat polyclonal | abcam | Cat# ab48031 |
| Anti-Centrin, rabbit | Gayek and Ohi44 | N/A |
| Anti-TCP1 eta, rabbit polyclonal | Novus Biologicals | Cat# NBP1–88144 |
| Anti-EB1, mouse monoclonal | BD Transduction Laboratories | Cat# 610535 |
| Anti-Kif18A, rabbit | Du et al.45 | N/A |
| Anti-TPPP, goat polyclonal | Thermo Fisher | Cat# PA5–19243 |
| Anti-CKAP2, mouse monoclonal, clone B-12 | Santa Crutz | Cat# sc-398286 |
| Anti-KifC1 (HSET), mouse monoclonal, clone 2B9 | Thermo Fisher | Cat# H00003833-M01 |
| Anti-MAP11, rabbit polyclonal | Sigma-Aldrich | Cat# HPA019359 |
| Anti-GCC185, rabbit polyclonal | Sigma-Aldrich | Cat# HPA035849 |
| Anti-CENPF, rabbit | Novus Biologicals | Cat# NBP2–56124 |
| Anti-CSAP | Backer et al.46 | N/A |
| Anti-Kif15 | Sturgill et al. 47 | N/A |
| Anti-SPECC1L, rabbit polyclonal | Proteintech | Cat# 25390–1-AP |
| Anti-MAP4, rabbit polyclonal | abcam | Cat# ab89650 |
| Anti-αB-crystallin, rabbit polyclonal | Thermo Fisher | Cat# PA1–16950 |
| Anti-PA-tag, rat monoclonal, clone NZ-1 | FUJIFILM Wako Pure Chemical | Cat# 016–25861 |
| Anti-GAPDH, mouse monoclonal, clone G-9 | Santa Crutz | Cat# sc-365062 |
| Anti-rat Alexa 594, goat | Thermo Fisher | Cat# A-11007 |
| Anti-rabbit Alexa 647, goat | Thermo Fisher | Cat# A-21245 |
| Anti-rat Alexa 680, goat | Thermo Fisher | Cat# A-21096 |
| Anti-rabbit Alexa 680, goat | Jackson ImmunoResearch Laboratorie | Cat# 711–625-152 |
| Anti-mouse Alexa 700, goat | Thermo Fisher | Cat# A-21036 |
| Anti-rabbit Alexa 700, goat | Thermo Fisher | Cat# A-21038 |
| Anti-goat Alexa 790, donkey | Thermo Fisher | Cat# A-11370 |
| Anti-mouse DyLight 800, goat | Thermo Fisher | Cat# SA5–10176 |
| Anti-rabbit IRDye 800CW, goat | LI-COR | Cat# 926–32211 |
| Bacterial and Virus Strains | ||
| XL1-Blue | Agilent | Cat# 200236 |
| DH5α | Invitrogen | Cat# 18258–012 |
| Rosetta2(DE3)pLysS | Millipore | Cat# 71403–3 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| DMEM, high glucose | Thermo Fisher | Cat# 11965118 |
| Opti-MEM I Reduced Serum Medium | Thermo Fisher | Cat# 31985070 |
| Leibovitz's L-15 Medium, no phenol red | Thermo Fisher | Cat# 21083027 |
| Grace's Insect Medium | Thermo Fisher | Cat# 11605094 |
| Insect-XPRESS Protein-free Insect Cell Medium with L-glutamine | Lonza | Cat# 12–730Q |
| Fetal bovine serum (FBS) | Atlanta Biologicals | Cat# S11150 |
| Fetal Bovine Serum (FBS), TET Tested | R&D Systems | Cat# S10350 |
| Penicillin and streptomycin | Thermo Fisher | Cat# 15140122 |
| Antibiotic-Antimycotic | Thermo Fisher | Cat# 15240062 |
| Puromycin | Sigma-Aldrich | Cat# P8833 |
| Doxycycline hydrochloride | Thermo Fisher | Cat# BP26531 |
| Pluronic F-68 Non-ionic Surfactant | Thermo Fisher | Cat# 24040032 |
| Lipofectamine 2000 | Invitrogen | Cat# 11668030 |
| PrimeSTAR max DNA polymerase | Takara Bio. | Cat# R045B |
| T4 Polynucleotide Kinase (PNK) | New England Biolabs | Cat# M0201S |
| T4 DNA ligase | New England Biolabs | Cat# M0202S |
| Carboxypeptidase A (CPA) from bovine pancreas | Sigma-Aldrich | Cat# C9268 |
| Paclitaxel (taxol) | Sigma-Aldrich | Cat# T7191 |
| Dithiothreitol (DTT) | Sigma-Aldrich | Cat# D9779 |
| GTP | Sigma-Aldrich | Cat# G8877 |
| Urea | GE Healthcare | Cat# 17–1319-01 |
| Nocodazole | Sigma-Aldrich | Cat# M1404 |
| SNAP-Cell, Oregon Green | New England BioLabs | Cat# S9104S |
| IPTG | Sigma-Aldrich | Cat# I6758 |
| cOmplete, EDTA-free Protease Inhibitor Cocktail | Roche | Cat# 04693159001 |
| PMSF | Sigma-Aldrich | Cat# 78830 |
| Benzonase nuclease | Sigma-Aldrich | Cat# E1014 |
| Lysozyme | Sigma-Aldrich | Cat# L6876 |
| Glutathione Sepharose 4B | GE Healthcare | Cat# 17075601 |
| Reduced glutathione | Sigma-Aldrich | Cat# G4251 |
| SIGMAFAST Protease Inhibitor Cocktail Tablets, EDTA-Free | Sigma-Aldrich | Cat# S8830 |
| Ni-NTA agarose | QIAGEN | Cat# 30230 |
| His-tagged TEV protease | This study | N/A |
| Novex WedgeWell 4 to 20%, Tris-Glycine, Mini protein gels | Invitrogen | Cat# XP04200BOX |
| Fractogel EMD SO3- (M) resin | Millipore-Sigma | Cat# 1168820010 |
| CF640R NHS-Ester | Biotium | Cat# 92108 |
| TAMRA; 5-(and-6)-Carboxytetramethylrhodamine, Succinimidyl Ester, mixed isomers | Thermo Fisher | Cat# C1171 |
| Pluronic-F127 | Sigma-Aldrich | Cat# P2443 |
| ATP | Sigma-Aldrich | Cat# A2383 |
| GMPCPP | Jena Bioscience | Cat# NU-405S |
| NeutrAvidin | Thermo Fisher | Cat# 31000 |
| BSA-biotin | Sigma-Aldrich | Cat# A8549 |
| His-EML2-S protein | This study | N/A |
| HeLa tubulin | PTL paper | N/A |
| HeLa tubulin with CPA-treatment | This paper | N/A |
| Bovine brain tubulin | PTL paper | N/A |
| CF640R-labeled bovine brain tubulin | This study | N/A |
| TAMRA-labeled bovine brain tubulin | This study | N/A |
| X-rhodamine-labeled porcine brain tubulin | Cytoskeleton Inc. | Cat# TL620M |
| Hilyte647-labeled porcine brain tubulin | Cytoskeleton Inc. | Cat# TL670M |
| GST protein | This study | N/A |
| GST-CTT Y protein | This study | N/A |
| GST-CTT ∆Y protein | This study | N/A |
| Critical Commercial Assays | ||
| TMTsixplex Isobaric Label Reagent Set, 1 x 0.8 mg | Thermo Fisher | Cat# 90061 |
| Bio-Rad Protein Assay (Bradford protein assay) | Bio-Rad | Cat# 5000006 |
| Deposited Data | ||
| Raw LC/MS data and search result tables | ProteomeXchange repository | PXD030448 |
| Experimental Models: Cell Lines | ||
| HeLa Kyoto | Shuh Narumiya | RRID: CVCL_1922 |
| Knock-in HeLa Kyoto cell line expressing mCherry-TubA1A | This study | N/A |
| Knock-in HeLa Kyoto cell line co-expressing PA-VASH1-GFP and SVBP-FLAG | Hotta et al.15 | N/A |
| Knock-in HeLa Kyoto cell line expressing PA-EML1 | This study | N/A |
| Knock-in HeLa Kyoto cell line expressing PA-EML2-L |
This study | N/A |
| Knock-in HeLa Kyoto cell line expressing PA-EML2-S | This study | N/A |
| Knock-in HeLa Kyoto cell line expressing PA-EML3 |
This study | N/A |
| Knock-in HeLa Kyoto cell line expressing PA-EML4 | This study | N/A |
| CHL-1 | Thijn Brummelkamp | RRID: CVCL_1122 |
| COS7 | This study | RRID:CVCL_0224 |
| Sf9 | This study | RRID:CVCL_0549 |
| High Five | This study | N/A |
| Oligonucleotides | ||
| TH460, AGCACCCAGTCCAAGCTGAGCAAAGAC, mutagenesis to generate monomeric EGFP with A207K mutation | This study | N/A |
| TH511, ACCCTCTCCTTCAACCGATGAATTAAGCTTGAGCTC, Insertion of TubA1A CTT to pGEX-KGT | This study | N/A |
| TH512, gaggaagaaggagaggaatactgactgactgacgatctgcct, Insertion of TubA1A CTT(Y) to pGEX-KGT | This study | N/A |
| TH513, gaggaagaaggagaggaatgactgactgacgatctgcct, Insertion of TubA1A CTT(∆Y) to pGEX-KGT | This study | N/A |
| TH581, taccgcgggcccgggatccaccggtcgccaccATGGTGAGCAAGGGCGAGGAGG, Inserting mCherry to pEM791-TubA1A | This study | N/A |
| TH582, cgagatctgagtccggacttgtacaGCTCGTCCATG, Inserting mCherry to pEM791-TubA1A | This study | N/A |
| TH607, gatctcgagctcaagcttcgATGCTGGAACGAAGGGCGTTGCTATG, Cloning the partial cDNA of EML2 into pPA-EGFP-C1 or the full length EML2-L into pmNeonGreen-C1 | This study | N/A |
| TH608, cgcggtaccgtcgactgcagaattcTTGCGGCCGCCCTGGTCCAC, Cloning the partial cDNA of EML2 into pPA-EGFP-C1 | This study | N/A |
| TH609, GAGGATGGCTCCGTGAAAATGTTCCTG, Correction of L222 to V | This study | N/A |
| TH610, ggtggaccagggcggccgcAAgGTCAGCCGCCTGGGC, Adding EML2 C-terminal 155 aa | This study | N/A |
| TH611, cgcggtaccgtcgactgcagTCAGACCACCCGCCACTG, Adding EML2 C-terminal 155 aa | This study | N/A |
| TH640, gatctcgagctcaagcttcgATGAGTAGCTTTGGAGCTGGCAAAACCAAAGAAGTTATC, Cloning EML2-S into pPA-EGFP-C1 | This study | N/A |
| TH641, taccgcgggcccgggatccaATGGGCGTTGCCATGCCA, Cloning PA-EMLs into pEM791 | This study | N/A |
| TH642, ctgcacctgagtgtttacttTCAGACCACCCGCCACTG, Cloning PA-EML2-L/S into pEM791 | This study | N/A |
| TH647, gtgccgaagatgatgtggtgCTGGAACGAAGGGCGTTG, Cloning EML2-L into pPA-EGFP-N1 | This study | N/A |
| TH648, ccgcctgaaccgcctccaccGACCACCCGCCACTGTAG, Cloning EML2-L/S into pPA-EGFP-N1 | This study | N/A |
| TH649, gtgccgaagatgatgtggtgAGTAGCTTTGGAGCTGGC, Cloning EML2-S into pPA-EGFP-N1 | This study | N/A |
| TH655, acgtaggcctttgaattccgTCAGACCACCCGCCACTG, Cloning EML2-S into pFastBac-HTA | This study | N/A |
| TH656, tgtattttcagggcgccatgagtagctttggagctggcaaaac, Cloning EML2-S into pFastBac-HTA | This study | N/A |
| TH657, tgggctgggtcctgcaggcgtgggcgttgccatgccag, Cloning EML2-L/S into pSNAPf | This study | N/A |
| TH658, taacctcgagtttaaacgcgttagaccacccgccactgtag, Cloning EML2-L/S into pSNAPf | This study | N/A |
| TH661, CAGCACCACATCATCTTCGGCAC, Removal of EGFP from pPA-EGFP-C1-EML2-L | This study | N/A |
| TH662, GAACGAAGGGCGTTGCTATGGCA, Removal of EGFP from pPA-EGFP-C1-EML2-L | This study | N/A |
| TH664, CACCACATCATCTTCGGCACCTG, Removal of EGFP from pPA-EGFP-C1-EML2-S | This study | N/A |
| TH665, agtagctttggagctGGCAAAACC, Removal of EGFP from pPA-EGFP-C1-EML2-S | This study | N/A |
| TH670, caccacatcatcttcggcacc, Amplifying pPA vector backbone | This study | N/A |
| TH671, tccggactcagatctcgagctc, Amplifying pPA vector backbone | This study | N/A |
| TH672, ggtgccgaagatgatgtggtggaggacggcttctccagctac, Cloning EML1 cDNA into pPA-EGFP-C1 | This study | N/A |
| TH674, ggtgccgaagatgatgtggtggacggggccgcggggcccggt, Cloning EML3 cDNA into pPA-EGFP-C1 | This study | N/A |
| TH675, agctcgagatctgagtccggatcaaacgtcgagggaggaggcgggggacaggg, Cloning EML3 cDNA into pPA-EGFP-C1 | This study | N/A |
| TH676, ggtgccgaagatgatgtggtggacggtttcgccggcagtctc, Cloning EML4 cDNA into pPA-EGFP-C1 | This study | N/A |
| TH677, agctcgagatctgagtccggattaggacgagggcgaagggtc, Cloning EML4 cDNA into pPA-EGFP-C1 | This study | N/A |
| TH702, agctcgagatctgagtccggaCtaaatgacgcgccactgcatg, Cloning EML1 cDNA into pPA-EGFP-C1 | This study | N/A |
| TH703, ctgcacctgagtgtttacttCTAAATGACGCGCCACTGC, Cloning PA-EML1 into pEM791 | This study | N/A |
| TH704, ctgcacctgagtgtttacttTCAAACGTCGAGGGAGGAGG, Cloning PA-EML3 into pEM791 | This study | N/A |
| TH705, ctgcacctgagtgtttacttTTAGGACGAGGGCGAAGG, Cloning PA-EML4 into pEM791 | This study | N/A |
| TH745, CAAATAAAGGTTGGCCGCGCAGTCTCGG, 2 R to A mutagenesis | This study | N/A |
| TH746, TTTGGCCCTGTGgcCACCGTGGCAGA, 2 R to A mutagenesis | This study | N/A |
| TH747, TGGAGGGGGCgcTGATgcGCGGGTGGTCCTCT, Additional 2 R to A mutagenesis | This study | N/A |
| TH748, CAAATAAAGGTTGGCCTCGCAGTCTCGG, R69E (EML2-S)/R270E (EML2-L) mutagenesis | This study | N/A |
| TH750, GGTGGCCACCCTTACAGCCTC, LR/YD mutagenesis | This study | N/A |
| TH753, GAAACCGAAGgATGTGCTGTGTGTG, LR/YD mutagenesis | This study | N/A |
| TH780, gatctcgagctcaagcttcgATGGAGGACGGCTTCTCC, Cloning EML1 into pmNeonGreen-C1 | This study | N/A |
| TH781, cgcggtaccgtcgactgcagCTAAATGACGCGCCACTG, Cloning EML1 into pmNeonGreen-C1 | This study | N/A |
| TH782, gatctcgagctcaagcttcgATGGACGGGGCCGCGGGG, Cloning EML3 into pmNeonGreen-C1 | This study | N/A |
| TH783, cgcggtaccgtcgactgcagTCAAACGTCGAGGGAGGAGGCGG, Cloning EML3 into pmNeonGreen-C1 | This study | N/A |
| TH784, gatctcgagctcaagcttcgATGGACGGTTTCGCCGGC, Cloning EML4 into pmNeonGreen-C1 | This study | N/A |
| TH785, cgcggtaccgtcgactgcagTTAGGACGAGGGCGAAGGG, Cloning EML4 into pmNeonGreen-C1 | This study | N/A |
| TH796, ggtgccgaagatgatgtggtgGGCAAAAAGAACAGTGAAAGCA, Cloning EML1-S into pPA-EGFP-C1 | This study | N/A |
| TH797, ggtgccgaagatgatgtggtgTTCCTTCGAGGGCGCCCCATTAC, Cloning EML3-S into pPA-EGFP-C1 | This study | N/A |
| TH798, ggtgccgaagatgatgtggtgAAAGTTACCAAAACTGCAGAC, Cloning EML4-S into pPA-EGFP-C1 | This study | N/A |
| TH870, GACGCAGAGCAGCCGCCGCCGCCGCCTTTAG, L94A/D96A (AAAA) mutagenesis | This study | N/A |
| TH902, gtgccgaagatgatgtggtgatgagcaacagaccgtcaac, Cloning EMAP cDNA into pPA-EGFP-C1 | This study | N/A |
| TH903, gctcgagatctgagtccggattacaccacgctccattg, Cloning EMAP cDNA into pPA-EGFP-C1 | This study | N/A |
| oMG89, catggacgagctgtacaagTCCGGACTCAGATCTCGAGTAatgcgtgagtgcatctcc, Cloning TubA1A cDNA into pEM791 | This study | N/A |
| oMG90, ggcagagggaaaaagatctcttagtattcctctccttcttc, Cloning TubA1A cDNA into pEM791 | This study | N/A |
| Recombinant DNA | ||
| EML1 cDNA | Horizon Discovery | Clone ID 5533599 |
| EML2 cDNA | Horizon Discovery | Clone ID 5177401 |
| EML3 cDNA | Horizon Discovery | Clone ID 3915493 |
| EML4 cDNA | Horizon Discovery | Clone ID 9021713 |
| TubA1A cDNA | Horizon Discovery | Clone ID 3528520 |
| pEGFP-C1 | Clontech | N/A |
| pmEGFP-C1 | This study | N/A |
| pPA-EGFP-C1-EML2-L | This study | N/A |
| pPA-EGFP-C1-EML2-S | This study | N/A |
| pPA-EGFP-N1-EML2-L | This study | N/A |
| pPA-EGFP-N1-EML2-S | This study | N/A |
| pSNAPf | New England BioLabs | Cat# N9183S |
| pSNAPf-EML2-L | This study | N/A |
| pSNAPf-EML2-S | This study | N/A |
| pPA-EML2-L | This study | N/A |
| pPA-EML2-S | This study | N/A |
| pPA-EML2-L TD | This study | N/A |
| pPA-EML2-S R69E | This study | N/A |
| pPA-EML2-S R69A/R341A (2RA) | This study | N/A |
| pPA-EML2-S R69A/R314A/R316A/R341A (4RA) | This study | N/A |
| pPA-EML2-S L209R/Y254D (LR/YD) | This study | N/A |
| pPA-EML2-L R270E | This study | N/A |
| pPA-EML2-L AAAA | This study | N/A |
| pPA-EML1 | This study | N/A |
| pPA-EML3 | This study | N/A |
| pPA-EML4 | This study | N/A |
| pPA-EML1-S | This study | N/A |
| pPA-EML3-S | This study | N/A |
| pPA-EML4-S |
This study | N/A |
| pPA-EMAP | This study | N/A |
| pEM791 | Eugene Makeyev; Khandelia et al.48 | N/A |
| pEM791-PA-EML1 | This study | N/A |
| pEM791-PA-EML2-L | This study | N/A |
| pEM791-PA-EML2-S | This study | N/A |
| pEM791-PA-EML3 | This study | N/A |
| pEM791-PA-EML4 | This study | N/A |
| pEM791-mCherry-TubA1A | This study | N/A |
| pmNeonGreen-C1 | Allele Biotechnology | N/A |
| pmNeonGreen-C1-EML2-L | This study | N/A |
| pmNeonGreen-C1-EML2-L R270E | This study | N/A |
| pmNeonGreen-C1-EML2-L AAAA | This study | N/A |
| pmNeonGreen-C1-EML2-L TD | This study | N/A |
| pmNeonGreen-C1-EML1 | This study | N/A |
| pmNeonGreen-C1-EML3 | This study | N/A |
| pmNeonGreen-C1-EML4 | This study | N/A |
| pFastBac-HT A | Thermo Fisher | Cat# 10584027 |
| pFastBac-EML2-S | This study | N/A |
| pFastBac-EML2-S R69E | This study | N/A |
| pGEX-KGT | This study | N/A |
| pGEX-KGT-αCTT(Y) | This study | N/A |
| pGEX-KGT-αCTT(∆Y) | This study | N/A |
| Software and Algorithms | ||
| Fiji/imageJ, version | NIH image | https://imagej.nih.gov/ij/; RRID: SCR_003070 |
| GraphPad Prism 9 | GraphPad Software | https://www.graphpad.com |
| OriginPro2020 | OriginLab | https://www.originlab.com/2020 |
| Python 3 | Python | https://www.python.org |
| Proteome Discoverer v2.1, v2.3 | Thermo Fisher | https://www.thermofisher.com/us/en/home/industrial/mass-spectrometry/liquid-chromatography-mass-spectrometry-lc-ms/lc-ms-software/multi-omics-data-analysis/proteome-discoverer-software.html |
| FlowJo v10.8.1 | BD Biosciences | https://www.flowjo.com |
| FragPipe version 17.1 | Alexey Nesvizhskii lab | https://msfragger.nesvilab.org/ |
| MSFragger version 3.4 | Alexey Nesvizhskii lab; Kong et al.49 | https://philosopher.nesvilab.org/ |
| Philosopher version 4.1.1 | Alexey Nesvizhskii lab; da Veiga Leprevost et al.50 | https://fragpipe.nesvilab.org/ |
| TMT-Integrator version 3.2.1 | Alexey Nesvizhskii lab | https://tmt-integrator.nesvilab.org/ |