TABLE 1.
Bacterial strains, plasmids, and oligonucleotides used in this study
| Strain, plasmid, or oligonucleotide | Relevant characteristic(s)a | Reference or source |
|---|---|---|
| Strains | ||
| C. testosteroni | ||
| R5 | Phl+, wild type, contains phc mPH genes | 55 |
| R5S | Phl+, ΔphcS::Tcr of R5 | This study |
| R5RS | Phl−, Δ(phcR-phcS)::Tcr of R5 | This study |
| TA441 | Phl−, wild type, contains aph mPH genes | 2 |
| P1 | Phl+, aphS mutant of TA441 | 1, 2 |
| P. putida CF600 | Phl+, wild type, contains dmp mPH genes | 40 |
| P. aeruginosa PAO1c | Phl− Cat+ | 21 |
| E. coli | ||
| DH5α | Host strain for DNA manipulation | Toyobo |
| S17-1 | Host strain for plasmid mobilization | 46 |
| Plasmids | ||
| pBluescript II KS(−) | Apr, cloning vector | Toyobo |
| pBSR502 | Apr, 7.8-kb SalI-Sse8387I fragment of pLAFRR501 cloned into SalI-PstI-cleaved pBluescript II KS(−) | 50 |
| pLAFRR501 | Tcr, 22-kb Sau3AI-digested (partially digested) DNA fragment from C. testosteroni R5 cloned into the BamHI site of pLAFR3 | 50 |
| pRO1614 | Apr/Cbr Tcr, cloning vector | 34 |
| pROR501 | Apr/Cbr, 11.1-kb XbaI-SalI fragment of pLAFRR501 cloned into NheI-SalI-cleaved pRO1614 | This study |
| pROR502 | Apr/Cbr, 7.8-kb BamHI-SalI fragment of pBSR502 cloned into pRO1614 | 50 |
| pROR504 | Apr/Cbr, 8.6-kb SalI fragment of pROR501 cloned into pRO1614 | This study |
| pMT5059 | Apr, pBR322 derivative carrying multiple cloning sites and an NotI site | 53 |
| pMT5056 | Apr Tcr, pBR322 derivative carrying a Tcr gene cartridge flanked by EcoRV and PvuII sites | 53 |
| pMT5071 | Cmr, plasmid containing an NotI-flanked mobilization cassette (the cassette contains the Cmr gene, sacB, and the Mob region) | 52 |
| pSK1 | Apr, 3.9-kb KpnI-SmaI fragment of pROR501 carrying the phcS gene cloned into pMT5059 | This study |
| pSK01S | Apr Tcr, 1.7-kb EcoRV fragment of pMT5056 carrying the Tcr gene cloned into a blunted ApaI-SacI site of pSK1 | This study |
| pSK02S | Apr/Cbr Tcr Cmr, NotI fragment carrying the mobilization cassette of pMT5071 cloned into pSK01S | This study |
| pBS2 | Apr, 4.0-kb Bgl/II-SacII (blunted) fragment of pROR501 carrying phcS and phcR genes cloned into pMT5059 | This study |
| pBS01RS | Apr Tcr, 1.7-kb EcoRV fragment of pMT5056 carrying the Tcr gene cloned into a blunted ApaI site of pBS2 | This study |
| pBS02RS | Apr/Cbr Tcr Cmr, NotI fragment carrying the mobilization cassette of pMT5071 cloned into pBS01RS | This study |
| pRW50 | Tcr, IncP, lacZ promoter-probe vector | 25 |
| pHSG398 | Cmr, cloning vector | Takara |
| pRC50 | Tcr Cmr, BstEII-cleaved PCR fragment carrying the Cmr gene amplified with Cm-BstEII-Fw and Cm-BstEII-Rv primers from pHSG398 cloned into a BstEII site of pRW50 | This study |
| pRC50Pk | Tcr Cmr, 2.2-kb EcoRV-BglII fragment of pROR501 and EcoRI-NotI-BamHI adapter (Takara) cloned into EcoRI-BamHI-cleaved pRC50; phcKL::lacZ transcriptional fusion | This study |
| pUC18 | Apr, cloning vector | Takara |
| pUC18Ps | Apr, 3.6-kb Sse8387I-NheI fragment of pROR501 cloned into a PstI-XbaI site of pUC18 | This study |
| pRC50Ps | Tcr Cmr, 3.6-kb HindIII-BamHI fragment of pUC18Ps carrying phcR cloned into pRC50, phcS::lacZ transcriptional fusion | This study |
| pBSNot | Apr, EcoRI-NotI-BamHI adapter (Takara) cloned into EcoRV-EcoRI-cleaved pBluescript II KS(−) | This study |
| pBSNotS | Apr, 1.5-kb MunI-EcoRV fragment carrying the phcS gene cloned into EcoRI-SmaI-cleaved pBSNot | This study |
| pKT231 | Kmr Smr, IncQ, broad-host-range cloning vector | 4 |
| pKT231S | Kmr, 1.5-kb NotI fragment of pBSNotS cloned into pKT231 | This study |
| pMMB67HE | Apr, IncQ, tac promoter | 17 |
| pHAM1102 | Apr, aphS in pMMB67HE | 1 |
| pET-29b(+) | Kmr, vector for protein expression | Novagen |
| pMMK67HE | Kmr, PacI-cleaved PCR fragment carrying the Kmr gene amplified with Km-Fw and Km-Rv primers from pET-29b(+) cloned into a PvuI site of pMMB67HE, Apr::Kmr | This study |
| pHAK1102 | Kmr, PacI-cleaved PCR fragment carrying the Kmr gene amplified with Km-Fw and Km-Rv primers from pET-29b(+) cloned into a PvuI site of pHAM1102, Apr::Kmr | This study |
| Oligonucleotides | ||
| Cm-BstEII-Fw | GGGGTTACCCGGAAGATCACTTCGC | |
| Cm-BstEII-Rv | GGGGTAACCGCACCAATAACTGCCT | |
| Km-Fw | CTTTAATTAAGGGATTTTGGTCATGAA | |
| Km-Rv | CATTAATTAATTCTTAGAAAAACTCATCG |
a
Abbreviations: Phl+, growth on phenol; Phl−, no growth on phenol; Cat+, growth on catechol; Apr, ampicillin resistant; Cbr, carbenicillin resistant; Apr/Cbr, resistant to both ampicillin and carbenicillin; Tcr, TET resistant; Cmr, CHL resistant; Kmr, KAN resistant; Smr, streptomycin resistant.