. Author manuscript; available in PMC: 2022 Oct 4.

Published in final edited form as: Psychiatr Genet. 2011 Feb;21(1):14–18. doi: 10.1097/YPG.0b013e32834133d2

Table 3.

MC1R haplotypes from 23-locus (SNP1–23)^a and depression status in Mexican Americans

Haplotype	Sequence ^b	Frequency	Case, Control Ratios	χ²	P value
H1	GGGCGCCGGGCTCGTGGCGGCAG	0.494	174.1:187.9, 187.4:182.6	0.477	0.4898
H2	GGGCGCCGGGCTCATGGCGGCAG	0.318	127.3:237.4, 105.3:264.7	3.397	0.0500
H3	GTGCGCCGGGCTCGTGGCGGCAG	0.049	16.5: 345.5, 19.2: 350.8	0.152	0.6965
H4	GGGCACCGGGCTCGTGGCGGCGG	0.046	14.0: 348.0, 20.0: 350.0	0.978	0.3227
H5	GGGCGCCGGGCTCGTGGCGGCGG	0.024	6.3: 355.7, 11.4: 358.6	1.365	0.2400

See Table 1 for definitions of the SNP1–23, and the haplotype is from 5’ to 3’ in MC1R.

The SNPs shown in bold and underlined in the haplotype are different ones compared with most common haplotype H1.