Appendix 1—key resources table.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Antibody | anti-CG2678#2 (Rabbit polyclonal) |
This paper | CG2678#2_4P39glyc, raised against Kipferl peptide R171-I190 | Anti-Kipferl polyclonal antibody, available from Brennecke lab; ChIP (7 µL per IP) |
Antibody | anti-CG2678 M4 (Mouse monoclonal) |
This paper | M4 3A6-3E1-E11, raised against Kipferl amino acids M2-K188 | Anti-Kipferl monoclonal WB antibody, available from Brennecke lab; WB (1:250) |
Antibody | anti-CG2678 M3 (Mouse monoclonal) |
This paper | M3 2 C5-3C3, raised against Kipferl amino acids M2-K188 | Anti-Kipferl monoclonal IF antibody, available from Brennecke lab; IF (1:500) |
Antibody | anti-Rhino (Mouse monoclonal) |
This paper | 6B7-F2, raised against full length denatured Rhino protein | Anti-Rhino monoclonal WB antibody, available from Brennecke lab; WB (1:10) |
Antibody | anti-Rhino (Rabbit polyclonal) |
Mohn et al., 2014 | Rhino#1_3573gly | ChIP (5 µL per IP), IF (1:1000) |
Antibody | anti-Deadlock (Mouse monoclonal) |
Andersen et al., 2017 | 5B5-6D7-3H10 | IF (1:100) |
Antibody | anti-Nxf3 (Mouse monoclonal) | ElMaghraby et al., 2019 | 8E4-F1 | IF (1:50) |
Antibody | Histone H3K9me3 antibody (Rabbit polyclonal) |
Active motif | ID_source:39161 | ChIP (5 µL per IP), IF (1:100) |
Antibody | Anti-Histone H3 (di methyl K9) (mouse monoclonal) |
Abcam | ID_source:mAbcam1220 | ChIP (5 µL per ChIP) |
Antibody | C1A9 HP1 (Su(var)2–5) (Mouse monoclonal) |
DSHB | ID_source:C1A9 | ChIP (5 µL per IP), IF (1:100) |
Antibody | ANTI-FLAG(R) M2 (Mouse monoclonal) |
Sigma Aldrich | ID_source:F1804-1MG | ChIP (2 µL per IP), IF (1:2000) |
genetic reagent (D. melanogaster) | w1118;;; | Bloomington stock 3605 | w 1118 | wildtype, cultivated in our lab for several years |
genetic reagent (D. melanogaster) | w;;; | Susan Celniker | iso1 | wildtype |
genetic reagent (D. melanogaster) | Cog-GAL4; NGT-GAL4; nos-GAL4; | Bloomington stock 31777 | Referred to as 'maternal triple driver' (MTD) |
Gal4 driver |
genetic reagent (D. melanogaster) | w;; pW20>w_sh[attP2]/TM3, Sb; | Mohn et al., 2014, VDRC-ID 313772 | white (CG2759) | RNAi line |
genetic reagent (D. melanogaster) | w;; pW20>rhi_sh[attP2]/TM3, Sb; | Mohn et al., 2014, VDRC-ID 313156 | Rhino (CG10683) | RNAi line |
genetic reagent (D. melanogaster) |
w;; pW20>CG2678_sh2 [attP2]/TM3, Sb; |
this paper | Kipferl (CG2678) | Kipferl RNAi line, available from VDRC; sh-oligo sequence: ctagcagtCTCGAAGG CTTTCATGCGTAA tagttatattcaagcata TTACGCATGAAA GCCTTCGAGgcg |
genetic reagent (D. melanogaster) |
w;; pGLKD >piwi_sh2 [attP2]/TM3,Sb; |
Senti and Brennecke, 2010, VDRC-ID 313199 | Piwi (CG6122) | RNAi line |
genetic reagent (D. melanogaster) |
w;; CG2678[Δ1] (dsRed+)/TM3,Sb; |
this paper | Kipferl (CG2678) | Kipferl mutant allele, available from VDRC; LB1-RMCEm31 |
genetic reagent (D. melanogaster) | w;; CG2678[Δ2](dsRed+)/TM3,Sb; | this paper | Kipferl (CG2678) | Kipferl mutant allele, available from VDRC; LB1-RMCEm21; has aberrant deregulation of blood transposon |
genetic reagent (D. melanogaster) | w;; CG2678[fs1]/TM3,Sb; | this paper | Kipferl (CG2678) | Kipferl mutant allele, available from VDRC; LB1-FSm52; indel (–7); sequence CCTGCGT CCTGGCCGTGC------- TTTCCGGTTCAAGT GGCAAAGCGAGCAGAG |
genetic reagent (D. melanogaster) |
w;; CG2678RMCE[S161- 3xFLAG]/TM3,Sb; |
this paper | Kipferl (CG2678) | Kipferl tagged construct (RMCE), available from VDRC; wildtype 3xFLAG tagged rescue construct inserted into LB1-RMCEm31 |
genetic reagent (D. melanogaster) |
w; prhino >3xFLAG/V5/ Precission/GFP- Rhino[attP40],rhi[g2m11]/CyO; CG2678[Δ1](dsRed+), nxf3[A2-2]/TM3,Sb; |
this paper | Rhino, Kipferl, Nxf3 | mutant allele combination, available from VDRC; Nxf3[A2-2] allele published in ElMaghraby et al., 2019 |
genetic reagent (D. melanogaster) | w; prhino >3xFLAG/V5/Precission/GFP-Rhino[attP40],rhi[g2m11]/CyO;; | this paper | Rhino (CG10683) | tagged Rhino construct, available from VDRC |
genetic reagent (D. melanogaster) | w; prhino >3xFLAG/V5/Precission/GFP-Rhino[attP40],rhi[g2m11]/CyO; CG2678[Δ1](dsRed+)/TM3,Sb; | this paper | Rhino, Kipferl | mutant allele combination, available from VDRC |
genetic reagent (D. melanogaster) | w; rhi[18-7]/CyO;; | Andersen et al., 2017, VDRC-ID 313488 | Rhino (CG10683) | mutant allele |
genetic reagent (D. melanogaster) | w; rhi[g2m11]/CyO;; | this paper | Rhino (CG10683) | Rhino mutant allele, available from VDRC; indel –7; seq: ATGTCT CGCAACCA-------cc-A ATCTTGGTCTGGTC GATGCACCGCCTAATG |
genetic reagent (D. melanogaster) | w;; pUASz >CG2678[attP2]; | this paper | Kipferl (CG2678) | tagged Kipferl construct, available from VDRC; intron containing CG2678 sequence including non-mapped exon3 |
genetic reagent (D. melanogaster) |
w;; CG2678RMCE [ΔZnFarray1-S161- 3xFLAG]/TM3,Sb; |
this paper | Kipferl (CG2678) | tagged Kipferl construct (RMCE), available from VDRC; 3xFLAG tagged ZnF array 1 deletion construct inserted into LB1-RMCEm31 |
genetic reagent (D. melanogaster) |
w;; CG2678RMCE [ΔZnFarray2-S161- 3xFLAG]/TM3,Sb; |
this paper | Kipferl (CG2678) | tagged Kipferl construct (RMCE), available from VDRC; 3xFLAG tagged ZnF array 2 deletion construct inserted into LB1-RMCEm31 |
genetic reagent (D. melanogaster) |
w;; CG2678RMCE [3xFLAG-ΔZAD]/TM3,Sb; |
this paper | Kipferl (CG2678) | tagged Kipferl construct (RMCE), available from VDRC; 3xFLAG tagged ZAD deletion construct inserted into LB1-RMCEm31 |
genetic reagent (D. melanogaster) | w;; CG2678RMCE[3xFLAG-ZAD::GCN4]/TM3,Sb; | this paper | Kipferl (CG2678) | tagged Kipferl construct (RMCE), available from VDRC; 3xFLAG tagged ZAD GCN4 replacement construct inserted into LB1- RMCEm31 |
genetic reagent (D. melanogaster) |
w;; CG2678RMCE [3xFLAG-ouibZAD]/TM3,Sb; |
this paper | Kipferl (CG2678) | Tagged Kipferl construct (RMCE), available from VDRC; 3xFLAG tagged ZAD replacement construct inserted into LB1-RMCEm31 |
genetic reagent (D. melanogaster) | w;; CG2678RMCE[ΔZnF#4-S161-3xFLAG]/TM3,Sb; | this paper | Kipferl (CG2678) | tagged Kipferl construct (RMCE), available from VDRC; 3xFLAG tagged ZnF4 deletion construct inserted into LB1-RMCEm31 |
genetic reagent (D. melanogaster) |
w; prhino >3xFLAG/V5/ Precission/GFP- Rhino(CSD::GCN4) [attP40],rhi[g3m13]/CyO;; |
this paper | Rhino (CG10683) | tagged Rhino construct, available from VDRC; Rhino indel –14; seq: TGGGCGTCCCCAGG---------------AGCGGTTTTCCGAA CGAGAACAACACC, Rhino CSD was replaced by the Gcn4 dimerization domain, homozygous not viable, crossed to w; rhi[18-7]/CyO;; for experiments |
genetic reagent (D. melanogaster) |
w; prhino >3xFLAG/ V5/Precission/GFP- Rhino(art.hinge) [attP40],rhi[g3m13]/CyO;; |
this paper | Rhino (CG10683) | tagged Rhino construct, available from VDRC; Rhino indel –14; seq: TGGGCGTCCCCAGG--------------- AGCGGTTTTCCGA ACGAGAACAACACC, Rhino hinge was replaced by a scrambled amino acid sequence of the same length, homozygous not viable, crossed to w; rhi[18-7]/CyO;; for experiments |
genetic reagent (D. melanogaster) |
w;; prhino >3xFLAG/ V5/Precission/GFP- Su(var)2-5[attP2]; |
this paper | HP1a (CG8409) | tagged HP1a construct, available from VDRC |
genetic reagent (D. melanogaster) |
w, 3xFLAG/V5/ Precission/GFP-HP1b;;; |
this paper | HP1b (CG7041) | Endogenously tagged HP1b, available from VDRC |
genetic reagent (D. melanogaster) |
w;; 3xFLAG/V5/ Precission/GFP-HP1c; |
this paper | HP1c (CG6990) | Endogenously tagged HP1c, available from VDRC |
genetic reagent (D. melanogaster) |
w; peggless >TurboID- linker-vhhGFP-3xHA- NLS[attP40]/CyO;; |
this paper | - | Transgenic construct, available from VDRC; TurboID biotin ligase fused to GFP nanobody |
genetic reagent (D. melanogaster) |
w;; 3xFLAG/V5/Precission/ GFP(replacing CG13741 CDS)-NLS [attP2]/TM3,Sb; |
ElMaghraby et al., 2019 | Boot (CG13741) | tagged construct; nuclear GFP used as contol |
Sequence-based reagent | Rhino_g2 | This paper | CRISRP guide RNA (indel) | GACCAAGATTTGGTCGCTGA |
Sequence-based reagent | Rhino_g3 | This paper | CRISRP guide RNA (indel) | GTCCCCAGGTTCTGGTGAAG |
Sequence-based reagent | CG2678_g1 | This paper | CRISRP guide RNA (RMCE left) | GTACAAATGATCAGTGCGA |
Sequence-based reagent | CG2679_g2 | This paper | CRISRP guide RNA (RMCE right) | GAAGGCATTAAGTAGCATG |
Sequence-based reagent | CG2678_g3 | This paper | CRISRP guide RNA (indel) | GAACCGGAAAGCATTCTGCA |
Sequence-based reagent | HP1b_g2 | This paper | CRISRP guide RNA (N-terminal endogenous tagging) | CACAATGGCCGAATTCTCAG |
Sequence-based reagent | HP1c_g2 | This paper | CRISRP guide RNA (N-terminal endogenous tagging) | GATGCGCTCCACCACGAAGT |
Strain, strain background (Saccharomyces cerevisiae) |
Matα, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4Δ, gal80Δ, GAL2- ADE2, LYS2::GAL1-HIS3, met2::GAL7-lacZ |
Mohn et al., 2014 | ||
Strain, strain background (Saccharomyces cerevisiae) |
MatA, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4Δ, gal80Δ, GAL2- ADE2, LYS2::GAL1-HIS3, met2::GAL7-lacZ |
Mohn et al., 2014 | ||
Strain, strain background (Saccharomyces cerevisiae) | pOAD | Mohn et al., 2014 | in YGS2 (MatA) | |
Strain, strain background (Saccharomyces cerevisiae) | pOAD-Rhino | Mohn et al., 2014 | in YGS2 (MatA) | |
Strain, strain background (Saccharomyces cerevisiae) | pOBD-Rhino | Mohn et al., 2014 | in YGS1 (Matα) | |
Strain, strain background (Saccharomyces cerevisiae) | pOAD-HP1a | Mohn et al., 2014 | in YGS2 (MatA) | |
Strain, strain background (Saccharomyces cerevisiae) | pOAD-Rhino(1-100) | Mohn et al., 2014 | in YGS2 (MatA) | |
Strain, strain background (Saccharomyces cerevisiae) | pOAD-Rhino(101-300) | Mohn et al., 2014 | in YGS2 (MatA) | |
Strain, strain background (Saccharomyces cerevisiae) | pOAD-Rhino(301-418) | Mohn et al., 2014 | in YGS2 (MatA) | |
Strain, strain background (Saccharomyces cerevisiae) | pOBD-CG2678-ZF4nolinker | this paper | Y2H construct, available from Brennecke lab; in YGS1 (Matα) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOBD-CG2678-190-311 | this paper | Y2H construct, available from Brennecke lab; in YGS1 (Matα) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678FL | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678frag1 | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678frag2 | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678frag3 | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678frag4 | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678frag5 | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678-ZF1-2 | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678-ZF1-3 | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678ZF2-4 | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678ZF3-4 | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678ZF4nolinker | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-OuibZAD | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-Rhi19-85 | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-CG2678-190-311 | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOBD-CG2678frag1 | this paper | Y2H construct, available from Brennecke lab; in YGS1 (Matα) |
|
Strain, strain background (Saccharomyces cerevisiae) | pOAD-HP1CD | this paper | Y2H construct, available from Brennecke lab; in YGS2 (MatA) |